Incidental Mutation 'R1724:Olfr651'
ID191676
Institutional Source Beutler Lab
Gene Symbol Olfr651
Ensembl Gene ENSMUSG00000073928
Gene Nameolfactory receptor 651
SynonymsGA_x6K02T2PBJ9-7179540-7180481, MOR31-11
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104550133-104554422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104553228 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 103 (F103S)
Ref Sequence ENSEMBL: ENSMUSP00000150776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098176] [ENSMUST00000216904]
Predicted Effect probably damaging
Transcript: ENSMUST00000098176
AA Change: F103S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095778
Gene: ENSMUSG00000073928
AA Change: F103S

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.1e-104 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1e-10 PFAM
Pfam:7tm_1 41 292 4.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216246
Predicted Effect probably damaging
Transcript: ENSMUST00000216904
AA Change: F103S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Olfr651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Olfr651 APN 7 104553092 missense probably benign 0.18
IGL01120:Olfr651 APN 7 104553345 missense probably benign
IGL01325:Olfr651 APN 7 104553689 missense probably damaging 1.00
IGL01590:Olfr651 APN 7 104553575 missense probably benign 0.00
IGL02625:Olfr651 APN 7 104553573 missense probably damaging 1.00
IGL02685:Olfr651 APN 7 104553150 missense probably benign 0.35
P0157:Olfr651 UTSW 7 104553507 missense probably damaging 1.00
R0087:Olfr651 UTSW 7 104553662 missense possibly damaging 0.73
R0399:Olfr651 UTSW 7 104553369 missense probably benign 0.05
R0547:Olfr651 UTSW 7 104553356 missense probably benign 0.01
R0630:Olfr651 UTSW 7 104553791 missense probably benign 0.27
R1014:Olfr651 UTSW 7 104553176 missense probably damaging 1.00
R1127:Olfr651 UTSW 7 104553086 missense possibly damaging 0.94
R2473:Olfr651 UTSW 7 104552939 missense possibly damaging 0.93
R3115:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3116:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3834:Olfr651 UTSW 7 104553345 missense probably benign 0.43
R4027:Olfr651 UTSW 7 104553323 missense possibly damaging 0.90
R4423:Olfr651 UTSW 7 104553345 missense probably benign
R4907:Olfr651 UTSW 7 104553311 missense probably damaging 0.97
R4984:Olfr651 UTSW 7 104553021 missense probably benign 0.38
R5266:Olfr651 UTSW 7 104553819 missense probably benign 0.00
R5592:Olfr651 UTSW 7 104553731 missense probably benign 0.28
R6441:Olfr651 UTSW 7 104553335 nonsense probably null
R7463:Olfr651 UTSW 7 104553482 missense possibly damaging 0.88
X0067:Olfr651 UTSW 7 104553387 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTTGTCCTCAGGCTCAAGAACCAG -3'
(R):5'- AGAAGCTCCTCACAATGATGCTCAC -3'

Sequencing Primer
(F):5'- CCTGGTTTGGAAAAGTTCCAC -3'
(R):5'- CAATGATGCTCACCATAATCTTGAC -3'
Posted On2014-05-14