Incidental Mutation 'R0118:Spem1'
ID20938
Institutional Source Beutler Lab
Gene Symbol Spem1
Ensembl Gene ENSMUSG00000041165
Gene Namesperm maturation 1
Synonyms
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0118 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location69820876-69822180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69821545 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 98 (K98E)
Ref Sequence ENSEMBL: ENSMUSP00000037500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045771] [ENSMUST00000056484] [ENSMUST00000056941] [ENSMUST00000108634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045771
AA Change: K98E

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165
AA Change: K98E

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056484
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056941
SMART Domains Protein: ENSMUSP00000051204
Gene: ENSMUSG00000044084

DomainStartEndE-ValueType
Pfam:Spem1 1 261 2e-121 PFAM
low complexity region 281 294 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108634
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display infertility, asthenozoospermia, teratozoospermia, and impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Spem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Spem1 APN 11 69821817 missense probably damaging 1.00
R0487:Spem1 UTSW 11 69821865 critical splice acceptor site probably null
R0734:Spem1 UTSW 11 69821271 missense probably damaging 1.00
R2483:Spem1 UTSW 11 69821518 missense possibly damaging 0.95
R4522:Spem1 UTSW 11 69821805 critical splice donor site probably null
R4866:Spem1 UTSW 11 69820929 missense probably damaging 1.00
R5297:Spem1 UTSW 11 69820927 missense probably damaging 1.00
R5404:Spem1 UTSW 11 69820937 missense probably damaging 1.00
R5672:Spem1 UTSW 11 69821437 missense probably damaging 1.00
R5989:Spem1 UTSW 11 69821125 missense possibly damaging 0.65
R6803:Spem1 UTSW 11 69821148 missense possibly damaging 0.84
R7234:Spem1 UTSW 11 69821804 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACCTCCTGCATAGATTGAAAGCC -3'
(R):5'- AATCCGCATCCTCTTACACCGAATG -3'

Sequencing Primer
(F):5'- TGCATAGATTGAAAGCCTTCCC -3'
(R):5'- GCTCCTTAAGACGGAGTTGC -3'
Posted On2013-04-11