Incidental Mutation 'R0118:Ccr3'
ID20935
Institutional Source Beutler Lab
Gene Symbol Ccr3
Ensembl Gene ENSMUSG00000035448
Gene Namechemokine (C-C motif) receptor 3
SynonymsCC-CKR3, MIP-1 alphaRL2, Cmkbr3, CKR3
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0118 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location124021972-124031689 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 124029610 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 327 (Y327*)
Ref Sequence ENSEMBL: ENSMUSP00000039107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039171]
Predicted Effect probably null
Transcript: ENSMUST00000039171
AA Change: Y327*
SMART Domains Protein: ENSMUSP00000039107
Gene: ENSMUSG00000035448
AA Change: Y327*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 49 320 7.9e-9 PFAM
Pfam:7tm_1 55 305 2.8e-52 PFAM
Meta Mutation Damage Score 0.6316 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in impaired eosinophil trafficking to the lungs and small intestine, and in increased bronchorestriction following methacholine challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Cpn2 T C 16: 30,260,368 R172G probably benign Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Ccr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccr3 APN 9 124029552 missense probably damaging 1.00
IGL03388:Ccr3 APN 9 124028621 splice site probably benign
PIT4810001:Ccr3 UTSW 9 124029608 missense probably benign 0.00
R0077:Ccr3 UTSW 9 124029024 missense probably damaging 1.00
R0504:Ccr3 UTSW 9 124029441 missense possibly damaging 0.69
R0576:Ccr3 UTSW 9 124029009 missense probably damaging 1.00
R0606:Ccr3 UTSW 9 124028802 missense probably benign 0.07
R2108:Ccr3 UTSW 9 124029299 missense possibly damaging 0.88
R3826:Ccr3 UTSW 9 124029677 missense possibly damaging 0.95
R4583:Ccr3 UTSW 9 124029440 missense probably benign 0.03
R4807:Ccr3 UTSW 9 124029297 missense probably damaging 1.00
R4823:Ccr3 UTSW 9 124028681 missense probably damaging 1.00
R4824:Ccr3 UTSW 9 124028772 missense probably damaging 1.00
R4932:Ccr3 UTSW 9 124029006 missense probably damaging 1.00
R5108:Ccr3 UTSW 9 124028931 missense probably benign 0.05
R5590:Ccr3 UTSW 9 124028793 missense probably damaging 1.00
R5610:Ccr3 UTSW 9 124029481 missense probably damaging 1.00
R5981:Ccr3 UTSW 9 124028783 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCTATCCAGAGGGTGAAGAAGAC -3'
(R):5'- TGAGAGCATCAGCATTGCATGGAG -3'

Sequencing Primer
(F):5'- TAAAACTCTGCTGAGATGTCCC -3'
(R):5'- ATGACTGAGCTAGAGGTCATTG -3'
Posted On2013-04-11