Incidental Mutation 'R2007:Eml6'
ID222527
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 040016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2007 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 29848814 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably null
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157510
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Dchs1 A T 7: 105,755,325 V2670E probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dgkh T A 14: 78,603,049 D530V probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Foxp2 G A 6: 15,396,819 C381Y probably damaging Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Osbp T C 19: 11,973,901 M270T probably benign Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Sipa1l2 G A 8: 125,439,437 T1486I probably damaging Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCAGGCTTTGTCTTTAAGTC -3'
(R):5'- ACCTCGCAGTAGGATCCAATG -3'

Sequencing Primer
(F):5'- GCAGGCTTTGTCTTTAAGTCTTCCC -3'
(R):5'- CAATGATGGCCCTGTAGATGTCTAC -3'
Posted On2014-08-25