Incidental Mutation 'R1796:Eml6'
ID202283
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 039826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29881975 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 232 (I232F)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: I232F

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: I232F

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpr179 T A 11: 97,336,556 D1591V possibly damaging Het
Gpsm2 A G 3: 108,701,850 V151A probably damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Itpr2 T C 6: 146,296,673 N1533S probably benign Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Loxhd1 C T 18: 77,405,907 R1521C probably damaging Het
Loxhd1 G A 18: 77,425,639 E1774K possibly damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Setd2 A T 9: 110,617,816 probably null Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc79 G T 12: 103,142,746 V2148F probably damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Vmn2r70 A T 7: 85,563,803 Y465* probably null Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGGTGGATTTAGTATGGATTCCCC -3'
(R):5'- CCTAGTTTTGGACACTATGTGGAAATG -3'

Sequencing Primer
(F):5'- CCCCAGGTGAGAAATCTTCATG -3'
(R):5'- CACTATGTGGAAATGCCCTGACTG -3'
Posted On2014-06-23