Incidental Mutation 'R2005:Abcb5'
ID225408
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118877827 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 961 (A961V)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: A961V

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: A961V

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTACTCTTCCTTGAGGTGC -3'
(R):5'- GGGCTAACTCCAAGGTTGTTTG -3'

Sequencing Primer
(F):5'- GGCACCTGATCTGAGCAGAATATTC -3'
(R):5'- TGGCTGTAGAGAGCACCTG -3'
Posted On2014-08-25