Incidental Mutation 'R2075:Nsd1'
ID227560
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2075 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55310500 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2142 (V2142A)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099490
AA Change: V2142A

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: V2142A

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224973
AA Change: V2039A

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCAGACTCAGGTTGATAAGATG -3'
(R):5'- AGCAGAGCTCTCAATGTGG -3'

Sequencing Primer
(F):5'- AGCTCAGGGTGTTGACTAATC -3'
(R):5'- AATGTGGGCACGTGCTTACAC -3'
Posted On2014-09-17