Incidental Mutation 'R2160:Cntnap4'
ID 235115
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Name contactin associated protein-like 4
Synonyms Caspr4, E130114F09Rik
MMRRC Submission 040163-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R2160 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 113296675-113609349 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 113484203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 419 (G419C)
Ref Sequence ENSEMBL: ENSMUSP00000112511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
AlphaFold Q99P47
Predicted Effect probably damaging
Transcript: ENSMUST00000034225
AA Change: G419C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: G419C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118171
AA Change: G419C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: G419C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125976
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,161,595 (GRCm39) N576D possibly damaging Het
Braf C T 6: 39,639,007 (GRCm39) C248Y probably damaging Het
Carmil2 A G 8: 106,423,680 (GRCm39) E1218G possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Dnah9 C T 11: 66,008,309 (GRCm39) D839N probably damaging Het
Evc2 A G 5: 37,537,862 (GRCm39) T517A possibly damaging Het
Fbxw8 G A 5: 118,263,053 (GRCm39) P209S probably damaging Het
Gcm1 A G 9: 77,968,662 (GRCm39) K121E probably benign Het
Gprc6a CAAA CA 10: 51,491,776 (GRCm39) probably null Het
Herc2 A G 7: 55,862,670 (GRCm39) D4077G probably benign Het
Inpp4b T A 8: 82,848,004 (GRCm39) L937* probably null Het
Ipcef1 A T 10: 6,840,650 (GRCm39) I349N probably damaging Het
Ipmk A G 10: 71,217,256 (GRCm39) T267A probably benign Het
Jph3 G T 8: 122,479,970 (GRCm39) R216L possibly damaging Het
Kctd16 A G 18: 40,392,138 (GRCm39) E242G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Krt76 A G 15: 101,796,820 (GRCm39) Y360H probably damaging Het
Lctl A G 9: 64,025,049 (GRCm39) I12V probably benign Het
Lrig3 T C 10: 125,833,565 (GRCm39) V347A possibly damaging Het
Lrrk2 C T 15: 91,680,263 (GRCm39) S2058F probably damaging Het
Mark2 G C 19: 7,260,112 (GRCm39) S111C probably damaging Het
Mon2 T A 10: 122,911,834 (GRCm39) K12* probably null Het
Nup58 A G 14: 60,476,957 (GRCm39) V238A probably benign Het
Pak5 T C 2: 135,940,302 (GRCm39) D504G probably benign Het
Pla2g4e T C 2: 120,015,687 (GRCm39) S286G probably benign Het
Ppfia4 A T 1: 134,241,461 (GRCm39) V498D probably benign Het
Ppfibp1 A G 6: 146,928,951 (GRCm39) E846G probably damaging Het
Ppp3ca G A 3: 136,583,391 (GRCm39) C166Y probably damaging Het
Prpf3 T C 3: 95,752,542 (GRCm39) K244E probably benign Het
Pzp A G 6: 128,502,239 (GRCm39) S37P probably damaging Het
Rab11fip3 G A 17: 26,288,028 (GRCm39) H42Y probably benign Het
Sprn C A 7: 139,733,419 (GRCm39) probably benign Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thap12 A G 7: 98,359,333 (GRCm39) S71G probably damaging Het
Vmn1r7 A G 6: 57,001,879 (GRCm39) F127S probably damaging Het
Vmn2r54 C T 7: 12,349,420 (GRCm39) V721I probably benign Het
Vmn2r56 A G 7: 12,428,146 (GRCm39) F707L probably benign Het
Zfp976 C T 7: 42,263,354 (GRCm39) S161N probably benign Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 113,494,251 (GRCm39) splice site probably benign
IGL01898:Cntnap4 APN 8 113,582,939 (GRCm39) missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 113,478,866 (GRCm39) missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 113,343,126 (GRCm39) missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 113,512,535 (GRCm39) splice site probably benign
IGL02621:Cntnap4 APN 8 113,537,355 (GRCm39) missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 113,500,222 (GRCm39) missense probably benign 0.06
IGL03327:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
IGL03346:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 113,512,416 (GRCm39) missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 113,569,148 (GRCm39) critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 113,583,143 (GRCm39) nonsense probably null
R0497:Cntnap4 UTSW 8 113,296,783 (GRCm39) missense probably benign 0.00
R1495:Cntnap4 UTSW 8 113,608,395 (GRCm39) missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 113,608,462 (GRCm39) missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 113,484,155 (GRCm39) missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 113,542,128 (GRCm39) missense probably benign 0.10
R2226:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 113,484,071 (GRCm39) missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R3917:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R4097:Cntnap4 UTSW 8 113,478,939 (GRCm39) missense probably benign 0.03
R4348:Cntnap4 UTSW 8 113,480,554 (GRCm39) missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 113,391,898 (GRCm39) missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 113,584,842 (GRCm39) missense probably benign 0.32
R4531:Cntnap4 UTSW 8 113,537,240 (GRCm39) missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 113,537,342 (GRCm39) missense probably benign
R4611:Cntnap4 UTSW 8 113,500,371 (GRCm39) critical splice donor site probably null
R4675:Cntnap4 UTSW 8 113,512,468 (GRCm39) missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 113,460,070 (GRCm39) missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 113,568,385 (GRCm39) missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 113,602,061 (GRCm39) missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 113,569,353 (GRCm39) missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 113,529,843 (GRCm39) missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 113,478,921 (GRCm39) missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 113,484,105 (GRCm39) missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 113,529,858 (GRCm39) missense probably benign 0.03
R7031:Cntnap4 UTSW 8 113,584,874 (GRCm39) missense probably benign 0.01
R7107:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 113,537,268 (GRCm39) missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 113,608,432 (GRCm39) missense probably benign 0.05
R7232:Cntnap4 UTSW 8 113,391,731 (GRCm39) splice site probably null
R7348:Cntnap4 UTSW 8 113,391,909 (GRCm39) missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 113,460,194 (GRCm39) critical splice donor site probably null
R7832:Cntnap4 UTSW 8 113,484,113 (GRCm39) missense probably benign
R7895:Cntnap4 UTSW 8 113,478,829 (GRCm39) missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 113,480,577 (GRCm39) missense probably damaging 0.99
R8185:Cntnap4 UTSW 8 113,391,897 (GRCm39) missense probably damaging 1.00
R8197:Cntnap4 UTSW 8 113,296,857 (GRCm39) missense probably benign 0.00
R8287:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
R8299:Cntnap4 UTSW 8 113,500,324 (GRCm39) missense probably damaging 1.00
R8498:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense possibly damaging 0.52
R8699:Cntnap4 UTSW 8 113,484,228 (GRCm39) missense probably damaging 1.00
R8774:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8774-TAIL:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8872:Cntnap4 UTSW 8 113,585,759 (GRCm39) missense possibly damaging 0.79
R8895:Cntnap4 UTSW 8 113,479,598 (GRCm39) missense probably benign 0.40
R8965:Cntnap4 UTSW 8 113,479,646 (GRCm39) missense probably damaging 1.00
R9189:Cntnap4 UTSW 8 113,602,600 (GRCm39) missense possibly damaging 0.92
R9260:Cntnap4 UTSW 8 113,500,276 (GRCm39) missense probably benign 0.08
R9474:Cntnap4 UTSW 8 113,460,103 (GRCm39) missense probably damaging 0.99
R9565:Cntnap4 UTSW 8 113,582,982 (GRCm39) missense probably benign 0.43
R9625:Cntnap4 UTSW 8 113,602,181 (GRCm39) missense possibly damaging 0.82
R9629:Cntnap4 UTSW 8 113,568,349 (GRCm39) missense probably damaging 1.00
R9745:Cntnap4 UTSW 8 113,391,808 (GRCm39) missense possibly damaging 0.89
R9765:Cntnap4 UTSW 8 113,568,496 (GRCm39) missense probably damaging 0.97
R9765:Cntnap4 UTSW 8 113,484,110 (GRCm39) missense probably benign 0.00
R9793:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
R9795:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
X0025:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 113,542,152 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 113,584,821 (GRCm39) missense possibly damaging 0.70
Z1186:Cntnap4 UTSW 8 113,479,002 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTCAGGGAAATGCCTC -3'
(R):5'- TGGATGGAAATTTCTACTCCCTC -3'

Sequencing Primer
(F):5'- AGGGAAATGCCTCCTTTTCTTG -3'
(R):5'- TCCTCTAAGGAAAGGTACTGATAATC -3'
Posted On 2014-10-01