Incidental Mutation 'R2171:Thbs1'
ID237460
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118122579 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 890 (G890D)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably damaging
Transcript: ENSMUST00000039559
AA Change: G890D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: G890D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190311
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGAGTAGAAGTTGACCTG -3'
(R):5'- TGCTATGATGAGTGGGTCAC -3'

Sequencing Primer
(F):5'- GAAGTTGACCTGTATTTGATTCACCC -3'
(R):5'- GAGTGGGTCACTATTTAACATCTTG -3'
Posted On2014-10-02