Incidental Mutation 'R2235:Ccdc129'
ID240387
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55897812 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 249 (H249L)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044729
AA Change: H249L

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: H249L

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACGGCATCAAAGTAGTTTAATGGC -3'
(R):5'- CATTTGACTTGCATCATGGCTAATGG -3'

Sequencing Primer
(F):5'- AGGTCGGTTCCAACAGTT -3'
(R):5'- TAATGGAAGCCACCTGTAGCTC -3'
Posted On2014-10-15