Incidental Mutation 'R3793:Ccdc129'
ID272646
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 040755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R3793 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55975603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 844 (M844L)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044729
AA Change: M844L

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: M844L

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,610,141 T35A probably benign Het
Arhgap32 T A 9: 32,255,373 S435R probably damaging Het
Asic1 A T 15: 99,672,025 K76* probably null Het
B9d1 A G 11: 61,507,622 probably benign Het
Casd1 T C 6: 4,619,876 V207A possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cnfn T C 7: 25,368,380 N45S probably benign Het
Col14a1 G T 15: 55,363,513 D220Y unknown Het
Csn1s1 T A 5: 87,680,843 Y274* probably null Het
Cyp2c69 T C 19: 39,881,156 T140A probably benign Het
Dlg2 A T 7: 91,810,535 probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
Ift172 C T 5: 31,257,581 D1366N possibly damaging Het
Itga4 A G 2: 79,279,128 T224A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt71 C T 15: 101,742,910 S46N probably damaging Het
Lhx1 A G 11: 84,521,900 S65P probably benign Het
Lingo4 A G 3: 94,402,378 S208G probably benign Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Nfrkb A T 9: 31,409,932 probably benign Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Nlrp14 A T 7: 107,182,274 Q226L probably benign Het
Ocln T C 13: 100,498,894 R496G possibly damaging Het
Olfr1360 T C 13: 21,674,983 probably null Het
Olfr866 T A 9: 20,027,063 I292F probably damaging Het
Osgepl1 T C 1: 53,320,247 I305T probably damaging Het
Ovgp1 A G 3: 105,980,171 N266S probably benign Het
Per1 A G 11: 69,109,301 E1273G probably benign Het
Plch1 A G 3: 63,697,831 Y1542H probably damaging Het
Pold1 A G 7: 44,541,570 F252L probably damaging Het
Ptk2b A T 14: 66,170,251 D607E probably damaging Het
Sdf4 T A 4: 156,002,459 probably null Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slco1b2 A G 6: 141,676,307 Y531C probably damaging Het
Tmem200a A T 10: 25,994,189 S61T probably damaging Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Uba2 A C 7: 34,146,297 V467G probably damaging Het
Ubr3 T C 2: 69,917,181 S263P possibly damaging Het
Ugt2b35 A G 5: 87,001,606 T239A probably benign Het
Wac T C 18: 7,920,190 V348A possibly damaging Het
Wdr3 A T 3: 100,151,965 M346K probably benign Het
Zfp607a A T 7: 27,878,906 H467L probably benign Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATCCAAGTGCCACTCAG -3'
(R):5'- CATCATGCTCATCTGGCCTG -3'

Sequencing Primer
(F):5'- AGTGCCACTCAGCAGCC -3'
(R):5'- GCCTGCCTGCCCTGATTAC -3'
Posted On2015-03-25