Incidental Mutation 'R2938:Cdh15'
ID 256111
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Name cadherin 15
Synonyms M cadherin, Mcad, Cdh14
MMRRC Submission 040515-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2938 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123575113-123594136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123588763 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 279 (R279Q)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
AlphaFold P33146
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: R279Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R279Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T A 2: 166,736,653 (GRCm39) I1775K probably damaging Het
Arhgap45 T A 10: 79,864,836 (GRCm39) M933K probably damaging Het
Astn2 A T 4: 65,910,550 (GRCm39) H427Q possibly damaging Het
Bace2 T C 16: 97,213,388 (GRCm39) probably null Het
Cacna1b A G 2: 24,496,540 (GRCm39) V125A probably benign Het
Cbarp T C 10: 79,967,603 (GRCm39) D539G probably damaging Het
Ccdc59 A T 10: 105,677,388 (GRCm39) K9M possibly damaging Het
Ccdc73 T A 2: 104,805,980 (GRCm39) L296* probably null Het
Cd40 G C 2: 164,911,622 (GRCm39) V191L probably benign Het
Cdc6 A G 11: 98,801,586 (GRCm39) I217V probably benign Het
Cdr1 T G X: 60,228,968 (GRCm39) D66A unknown Het
Cela3b A G 4: 137,150,574 (GRCm39) I208T probably benign Het
Col1a2 A T 6: 4,520,788 (GRCm39) Q375L possibly damaging Het
Csn1s1 A T 5: 87,824,995 (GRCm39) Q221L possibly damaging Het
Cstl1 T A 2: 148,592,977 (GRCm39) I44N possibly damaging Het
Depdc5 G A 5: 33,058,965 (GRCm39) probably null Het
Dthd1 A G 5: 63,000,300 (GRCm39) I541V probably benign Het
Eml6 G A 11: 29,783,049 (GRCm39) probably benign Het
Fkbp15 T A 4: 62,222,900 (GRCm39) T1000S probably benign Het
Gimap8 A T 6: 48,635,730 (GRCm39) R498S possibly damaging Het
Glis1 A G 4: 107,489,488 (GRCm39) N692D possibly damaging Het
Gpr83 A G 9: 14,776,167 (GRCm39) T163A probably benign Het
Hmgcr G A 13: 96,799,576 (GRCm39) L173F probably damaging Het
Htr2b T A 1: 86,030,177 (GRCm39) I173F possibly damaging Het
Ifna11 T C 4: 88,738,530 (GRCm39) L112P probably damaging Het
Lmod1 A G 1: 135,291,654 (GRCm39) K170E probably benign Het
Lrrtm1 A T 6: 77,220,635 (GRCm39) M31L probably benign Het
Macf1 T C 4: 123,326,695 (GRCm39) N2815S probably damaging Het
Man1c1 A G 4: 134,430,263 (GRCm39) I173T possibly damaging Het
Man2b2 A G 5: 36,978,330 (GRCm39) I318T probably benign Het
Mib1 T A 18: 10,752,033 (GRCm39) probably benign Het
Myo10 T A 15: 25,795,803 (GRCm39) S1315T probably damaging Het
Nsun5 C T 5: 135,404,317 (GRCm39) Q375* probably null Het
Opcml A G 9: 27,702,682 (GRCm39) M1V probably null Het
Or4d5 A T 9: 40,012,039 (GRCm39) I249K probably benign Het
Or5m3 T C 2: 85,838,357 (GRCm39) M79T probably damaging Het
Or6c66b T A 10: 129,376,484 (GRCm39) F26Y probably damaging Het
Parm1 T C 5: 91,742,328 (GRCm39) I232T possibly damaging Het
Pdss1 T A 2: 22,796,799 (GRCm39) probably null Het
Pfkfb2 G A 1: 130,633,147 (GRCm39) T202I possibly damaging Het
Postn T A 3: 54,277,731 (GRCm39) F242Y probably damaging Het
Prss12 A G 3: 123,280,625 (GRCm39) T437A probably benign Het
Rap1gap2 C A 11: 74,298,148 (GRCm39) A491S possibly damaging Het
Rbm10 T C X: 20,513,934 (GRCm39) L429P possibly damaging Het
Saraf A G 8: 34,635,735 (GRCm39) N346D probably benign Het
Sec31b T C 19: 44,524,618 (GRCm39) D93G probably damaging Het
Sgcg A T 14: 61,467,074 (GRCm39) F175L probably damaging Het
Sh3rf2 A G 18: 42,282,789 (GRCm39) D449G probably benign Het
Slc9a3 T C 13: 74,269,788 (GRCm39) I52T possibly damaging Het
Tcf7 A T 11: 52,173,610 (GRCm39) probably null Het
Tlr1 A G 5: 65,083,251 (GRCm39) V442A probably damaging Het
Tmub1 A G 5: 24,650,922 (GRCm39) *261Q probably null Het
Uck1 GCCAACACC GCC 2: 32,146,088 (GRCm39) probably benign Het
Utp4 A G 8: 107,649,561 (GRCm39) D670G probably damaging Het
Vamp5 A G 6: 72,346,323 (GRCm39) V91A probably benign Het
Vmn1r35 A T 6: 66,655,950 (GRCm39) M73K possibly damaging Het
Vmn2r12 C T 5: 109,239,397 (GRCm39) E389K probably damaging Het
Wdsub1 T C 2: 59,703,630 (GRCm39) T112A possibly damaging Het
Xpo4 G T 14: 57,841,897 (GRCm39) Q473K probably benign Het
Xpo7 A G 14: 70,909,130 (GRCm39) I797T probably damaging Het
Zfp808 G A 13: 62,319,032 (GRCm39) V67M probably benign Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 123,592,062 (GRCm39) intron probably benign
IGL01958:Cdh15 APN 8 123,586,089 (GRCm39) missense probably damaging 1.00
IGL02588:Cdh15 APN 8 123,583,291 (GRCm39) nonsense probably null
IGL02793:Cdh15 APN 8 123,587,721 (GRCm39) missense probably damaging 1.00
IGL02947:Cdh15 APN 8 123,592,111 (GRCm39) missense probably benign 0.00
R0310:Cdh15 UTSW 8 123,592,175 (GRCm39) missense probably damaging 1.00
R0441:Cdh15 UTSW 8 123,587,705 (GRCm39) missense probably damaging 1.00
R0766:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R0898:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1023:Cdh15 UTSW 8 123,591,939 (GRCm39) missense probably damaging 0.98
R1054:Cdh15 UTSW 8 123,591,076 (GRCm39) missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R1081:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1101:Cdh15 UTSW 8 123,587,585 (GRCm39) missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1209:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1210:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1312:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R1317:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1318:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1393:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1428:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1429:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1695:Cdh15 UTSW 8 123,588,755 (GRCm39) missense probably benign 0.05
R2157:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2170:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2178:Cdh15 UTSW 8 123,591,715 (GRCm39) splice site probably null
R2252:Cdh15 UTSW 8 123,584,161 (GRCm39) missense probably damaging 1.00
R2290:Cdh15 UTSW 8 123,586,056 (GRCm39) missense probably damaging 1.00
R2317:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2330:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2345:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2349:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2353:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2354:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2566:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2567:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2568:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2893:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2894:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2937:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2990:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2992:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2993:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3029:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3030:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3195:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R3441:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3442:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3608:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3686:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4119:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4120:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4477:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4478:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4480:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4580:Cdh15 UTSW 8 123,591,897 (GRCm39) missense probably damaging 0.99
R4583:Cdh15 UTSW 8 123,591,767 (GRCm39) missense probably damaging 0.98
R4619:Cdh15 UTSW 8 123,587,612 (GRCm39) missense probably damaging 1.00
R4694:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4731:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R5076:Cdh15 UTSW 8 123,591,087 (GRCm39) missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 123,588,802 (GRCm39) missense probably null 1.00
R5375:Cdh15 UTSW 8 123,591,839 (GRCm39) missense probably damaging 1.00
R5498:Cdh15 UTSW 8 123,591,917 (GRCm39) missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 123,583,326 (GRCm39) missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 123,591,086 (GRCm39) missense probably benign 0.01
R6570:Cdh15 UTSW 8 123,584,130 (GRCm39) missense probably damaging 1.00
R6708:Cdh15 UTSW 8 123,590,294 (GRCm39) missense probably benign 0.32
R7505:Cdh15 UTSW 8 123,575,231 (GRCm39) missense probably benign 0.01
R7527:Cdh15 UTSW 8 123,588,865 (GRCm39) missense probably damaging 1.00
R7724:Cdh15 UTSW 8 123,593,700 (GRCm39) missense probably damaging 1.00
R8093:Cdh15 UTSW 8 123,593,574 (GRCm39) missense probably damaging 1.00
R8485:Cdh15 UTSW 8 123,584,105 (GRCm39) missense probably damaging 1.00
R8759:Cdh15 UTSW 8 123,587,628 (GRCm39) missense probably damaging 1.00
R8910:Cdh15 UTSW 8 123,575,240 (GRCm39) missense probably benign 0.04
R9017:Cdh15 UTSW 8 123,584,256 (GRCm39) critical splice donor site probably null
R9453:Cdh15 UTSW 8 123,586,029 (GRCm39) missense probably damaging 0.99
R9699:Cdh15 UTSW 8 123,588,769 (GRCm39) missense probably benign 0.00
R9705:Cdh15 UTSW 8 123,591,024 (GRCm39) missense probably damaging 1.00
Z1176:Cdh15 UTSW 8 123,590,998 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTCCAATATCCAGGAGC -3'
(R):5'- GATTCTAGCTGAGGGAACACAC -3'

Sequencing Primer
(F):5'- TGGGATCCATGGCTCTGGAAAC -3'
(R):5'- TTCTAGCTGAGGGAACACACATGAC -3'
Posted On 2014-12-29