Incidental Mutation 'R3837:Skap2'
List |< first << previous [record 41 of 53] next >> last >|
ID275691
Institutional Source Beutler Lab
Gene Symbol Skap2
Ensembl Gene ENSMUSG00000059182
Gene Namesrc family associated phosphoprotein 2
SynonymsSaps, RA70, SKAP-HOM, mSKAP55R, 2610021A10Rik
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location51857422-52012549 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 51909299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078214] [ENSMUST00000203948] [ENSMUST00000203948] [ENSMUST00000204778]
Predicted Effect probably null
Transcript: ENSMUST00000078214
SMART Domains Protein: ENSMUSP00000077342
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203948
SMART Domains Protein: ENSMUSP00000145275
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
Blast:PH 1 49 1e-28 BLAST
PDB:1U5F|A 1 74 1e-30 PDB
SH3 83 126 3e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203948
SMART Domains Protein: ENSMUSP00000145275
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
Blast:PH 1 49 1e-28 BLAST
PDB:1U5F|A 1 74 1e-30 PDB
SH3 83 126 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204178
Predicted Effect probably null
Transcript: ENSMUST00000204778
SMART Domains Protein: ENSMUSP00000145462
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal. Homozygotes for a gene-trapped allele show impaired B-cell responses and B-cell adhesion, decreased susceptibility to EAE, abnormal dendritic cell physiology, fast extinction of fear memory, and impaired social memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Skap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Skap2 APN 6 51921300 missense probably damaging 1.00
IGL01526:Skap2 APN 6 51907914 missense probably benign 0.20
IGL01543:Skap2 APN 6 52012395 missense possibly damaging 0.88
IGL01879:Skap2 APN 6 51996034 missense possibly damaging 0.90
IGL01893:Skap2 APN 6 51874576 missense probably damaging 1.00
IGL02154:Skap2 APN 6 52012328 splice site probably benign
IGL02406:Skap2 APN 6 51874473 critical splice donor site probably null
IGL02409:Skap2 APN 6 51907958 missense possibly damaging 0.51
IGL02937:Skap2 APN 6 51909371 missense probably benign 0.01
R0648:Skap2 UTSW 6 51879785 missense probably benign 0.05
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R2370:Skap2 UTSW 6 51921330 missense probably damaging 1.00
R4847:Skap2 UTSW 6 52003669 missense probably benign 0.01
R4939:Skap2 UTSW 6 51922323 missense possibly damaging 0.49
R5555:Skap2 UTSW 6 51860018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGATATAACACTTGAACCGATCAG -3'
(R):5'- TCCTTCTGAATAGCACCACAG -3'

Sequencing Primer
(F):5'- CATGTTGGGGAAAGCTGT -3'
(R):5'- AGCTGACTAAAATTTCTCCTGTGTC -3'
Posted On2015-04-06