Incidental Mutation 'R3747:Spon1'
ID309860
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Namespondin 1, (f-spondin) extracellular matrix protein
SynonymsFSP, D330035F22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location113765998-114043370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114016791 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 297 (V297E)
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046687
AA Change: V297E

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: V297E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
rust UTSW 7 114016791 missense possibly damaging 0.77
wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCCAGACTAGGAACACTCAG -3'
(R):5'- CCTGTAGTCCCAAGAAGACAAGG -3'

Sequencing Primer
(F):5'- ACCTCCTAGTGTAGCTGGCATG -3'
(R):5'- TGTAGTCCCAAGAAGACAAGGTTTCC -3'
Posted On2015-04-17