Incidental Mutation 'R3747:Tpcn2'
ID309866
Institutional Source Beutler Lab
Gene Symbol Tpcn2
Ensembl Gene ENSMUSG00000048677
Gene Nametwo pore segment channel 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3747 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location145186524-145284011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145255523 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 682 (H682R)
Ref Sequence ENSEMBL: ENSMUSP00000061308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058022] [ENSMUST00000208148] [ENSMUST00000208328] [ENSMUST00000208841] [ENSMUST00000209047]
Predicted Effect probably damaging
Transcript: ENSMUST00000058022
AA Change: H682R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061308
Gene: ENSMUSG00000048677
AA Change: H682R

DomainStartEndE-ValueType
Pfam:Ion_trans 67 302 5.1e-24 PFAM
Pfam:Ion_trans 415 683 1.5e-29 PFAM
low complexity region 709 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208148
Predicted Effect probably benign
Transcript: ENSMUST00000208328
Predicted Effect probably benign
Transcript: ENSMUST00000208841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208867
Predicted Effect probably benign
Transcript: ENSMUST00000209047
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit altered beta cell calcium ion physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abhd18 A G 3: 40,933,573 N284S probably benign Het
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam26b A C 8: 43,521,197 V256G probably benign Het
Aga T A 8: 53,517,821 I192N probably benign Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Alk A G 17: 71,911,565 S762P probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cby3 T C 11: 50,359,674 *236R probably null Het
Cfhr1 C A 1: 139,557,634 probably null Het
Clcn1 T A 6: 42,299,915 Y393N probably damaging Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Cyp3a16 T A 5: 145,442,071 K380M probably damaging Het
Cyp4v3 G A 8: 45,315,708 R272* probably null Het
Dazap1 C T 10: 80,287,664 R391C possibly damaging Het
Dgkh T A 14: 78,584,445 E876V probably damaging Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam221a A G 6: 49,372,696 D2G probably damaging Het
Fam43a C T 16: 30,601,846 T416I probably benign Het
Fam71a T G 1: 191,164,010 Q145H probably damaging Het
Fam90a1a C A 8: 21,963,205 S192* probably null Het
Foxd1 G C 13: 98,355,916 A433P unknown Het
Gm10152 G A 7: 144,763,200 probably null Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Hipk3 T A 2: 104,441,283 R435* probably null Het
Hnrnpab T A 11: 51,602,646 Y245F probably benign Het
Islr2 A T 9: 58,199,642 S112T probably benign Het
Itgb7 A T 15: 102,222,777 V280D probably damaging Het
Kndc1 G A 7: 139,927,904 probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nbeal1 A G 1: 60,195,023 D51G probably damaging Het
Ncoa6 G A 2: 155,411,641 P939L probably benign Het
Ndst3 A G 3: 123,671,552 I257T probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,356 probably benign Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcm1 T C 8: 41,332,004 I2064T probably benign Het
Pkd1 A G 17: 24,591,461 R90G possibly damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Ppil4 A T 10: 7,814,693 Q370L probably benign Het
Primpol A T 8: 46,599,813 D154E probably benign Het
Rb1cc1 T G 1: 6,248,742 V778G possibly damaging Het
Sgms1 A T 19: 32,159,594 S191T possibly damaging Het
Sned1 T A 1: 93,261,751 F303Y probably damaging Het
Sp9 T A 2: 73,274,308 M402K probably damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Ugt1a6a T C 1: 88,139,149 Y226H probably damaging Het
Upf1 G T 8: 70,333,350 N975K possibly damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r39 T C 6: 66,804,870 N155D probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Yipf4 G A 17: 74,496,672 probably null Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zswim4 G A 8: 84,212,047 P1069S possibly damaging Het
Other mutations in Tpcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Tpcn2 APN 7 145267378 missense probably damaging 1.00
IGL02112:Tpcn2 APN 7 145256792 missense probably benign 0.18
IGL02646:Tpcn2 APN 7 145258574 missense probably benign 0.03
R0385:Tpcn2 UTSW 7 145277174 missense probably damaging 1.00
R1441:Tpcn2 UTSW 7 145260134 missense probably benign
R1498:Tpcn2 UTSW 7 145268911 missense probably damaging 1.00
R1598:Tpcn2 UTSW 7 145277220 nonsense probably null
R2127:Tpcn2 UTSW 7 145273975 splice site probably benign
R2354:Tpcn2 UTSW 7 145257218 missense probably damaging 1.00
R3748:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R3749:Tpcn2 UTSW 7 145255523 missense probably damaging 0.97
R4775:Tpcn2 UTSW 7 145267342 missense probably damaging 1.00
R4835:Tpcn2 UTSW 7 145272351 missense probably damaging 0.98
R4931:Tpcn2 UTSW 7 145267309 missense probably benign 0.34
R4979:Tpcn2 UTSW 7 145260096 missense probably benign
R5185:Tpcn2 UTSW 7 145255454 missense probably damaging 1.00
R5418:Tpcn2 UTSW 7 145278781 missense probably damaging 1.00
R5443:Tpcn2 UTSW 7 145255472 missense possibly damaging 0.46
R5623:Tpcn2 UTSW 7 145267334 missense possibly damaging 0.76
R5716:Tpcn2 UTSW 7 145257813 missense possibly damaging 0.94
R5910:Tpcn2 UTSW 7 145260982 missense probably benign 0.01
R5927:Tpcn2 UTSW 7 145278784 missense probably damaging 0.99
R6015:Tpcn2 UTSW 7 145266851 missense probably damaging 1.00
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6036:Tpcn2 UTSW 7 145268869 missense possibly damaging 0.93
R6299:Tpcn2 UTSW 7 145262243 missense probably damaging 1.00
R6337:Tpcn2 UTSW 7 145279343 missense probably damaging 1.00
R6382:Tpcn2 UTSW 7 145269749 missense possibly damaging 0.88
R6724:Tpcn2 UTSW 7 145256520 missense probably benign 0.00
R6995:Tpcn2 UTSW 7 145256785 missense probably benign 0.00
Y4335:Tpcn2 UTSW 7 145257235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTCACCATCATGCTGTG -3'
(R):5'- TGAAGCTGGGCATCTTGCTG -3'

Sequencing Primer
(F):5'- CTCAGCAGCAGTCCAGATG -3'
(R):5'- CTGGGCATCTTGCTGTTTCAG -3'
Posted On2015-04-17