Incidental Mutation 'R3978:Il27ra'
ID311128
Institutional Source Beutler Lab
Gene Symbol Il27ra
Ensembl Gene ENSMUSG00000005465
Gene Nameinterleukin 27 receptor, alpha
SynonymsIL-27R, WSX-1, Tccr
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84030294-84042589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84040684 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 170 (T170I)
Ref Sequence ENSEMBL: ENSMUSP00000005601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000061923]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
AA Change: T170I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465
AA Change: T170I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061923
SMART Domains Protein: ENSMUSP00000051392
Gene: ENSMUSG00000045232

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IlGF 31 140 5.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210790
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: T helper 1 response and responses to parasitic and bacterial infection are altered in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Il27ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Il27ra APN 8 84031535 missense probably benign 0.01
IGL03096:Il27ra APN 8 84031532 missense probably damaging 1.00
IGL03334:Il27ra APN 8 84031122 missense probably benign 0.08
angel UTSW 8 84032144 critical splice acceptor site probably null
R0133:Il27ra UTSW 8 84033942 unclassified probably benign
R0526:Il27ra UTSW 8 84039499 missense probably benign 0.37
R2914:Il27ra UTSW 8 84031613 unclassified probably benign
R3001:Il27ra UTSW 8 84032031 nonsense probably null
R3002:Il27ra UTSW 8 84032031 nonsense probably null
R3003:Il27ra UTSW 8 84032031 nonsense probably null
R3851:Il27ra UTSW 8 84040688 missense probably benign 0.00
R4589:Il27ra UTSW 8 84036409 missense probably damaging 1.00
R4997:Il27ra UTSW 8 84039527 nonsense probably null
R5133:Il27ra UTSW 8 84034059 missense possibly damaging 0.71
R5955:Il27ra UTSW 8 84040822 missense probably benign 0.05
R6153:Il27ra UTSW 8 84032144 critical splice acceptor site probably null
R6489:Il27ra UTSW 8 84031550 missense probably benign 0.02
X0013:Il27ra UTSW 8 84042159 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TTTACCGAGCCATCTCCCAG -3'
(R):5'- TGTGAACCTGGAGACCCAAAG -3'

Sequencing Primer
(F):5'- TTTCAGGCTAGCCGGGATCATAC -3'
(R):5'- TGAAGGCCTGAGCTCAGTG -3'
Posted On2015-04-29