Incidental Mutation 'R3978:Hr'
ID311151
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70563584 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 699 (T699A)
Ref Sequence ENSEMBL: ENSMUSP00000124042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably benign
Transcript: ENSMUST00000022691
AA Change: T670A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: T670A

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161069
AA Change: T670A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: T670A

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163060
AA Change: T699A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: T699A

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably null Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Vmn2r68 T A 7: 85,232,462 Y470F probably benign Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGATCCTGACCCAGTTTG -3'
(R):5'- CCACAGAGAAAGGTTCCTCC -3'

Sequencing Primer
(F):5'- AGTTTGTCTCCAGCCAGGG -3'
(R):5'- AGGTCAGTTATCTGCATGCACAC -3'
Posted On2015-04-29