Incidental Mutation 'R4564:Gfra1'
ID343275
Institutional Source Beutler Lab
Gene Symbol Gfra1
Ensembl Gene ENSMUSG00000025089
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 1
SynonymsGDNFR-alpha, GFR alpha-1
MMRRC Submission 041789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4564 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58235604-58455909 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 58239250 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026076] [ENSMUST00000129100] [ENSMUST00000140141] [ENSMUST00000152507] [ENSMUST00000169850]
Predicted Effect probably null
Transcript: ENSMUST00000026076
SMART Domains Protein: ENSMUSP00000026076
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129100
SMART Domains Protein: ENSMUSP00000117196
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 149 228 6.55e-24 SMART
GDNF 238 332 1.62e-28 SMART
low complexity region 357 365 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140141
SMART Domains Protein: ENSMUSP00000123022
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143595
Predicted Effect probably null
Transcript: ENSMUST00000152507
SMART Domains Protein: ENSMUSP00000120333
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169850
SMART Domains Protein: ENSMUSP00000130128
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Meta Mutation Damage Score 0.6188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack kidneys and enteric neurons resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad3a C T 4: 155,747,309 probably null Het
Bach2 T G 4: 32,563,338 S602A probably damaging Het
Ccl19 G T 4: 42,756,295 S12R probably damaging Het
Cfap54 T C 10: 92,839,540 probably benign Het
Cndp1 T A 18: 84,622,286 I265F probably damaging Het
Cnot3 G A 7: 3,653,258 R181H probably damaging Het
Dicer1 T A 12: 104,704,751 K1011* probably null Het
Dip2b G A 15: 100,157,258 W99* probably null Het
Fam129c T C 8: 71,605,060 probably benign Het
Fpr-rs6 A T 17: 20,182,906 Y64* probably null Het
Fubp1 C A 3: 152,222,936 Y480* probably null Het
Gm10770 T C 2: 150,178,911 T229A probably benign Het
Gm826 A C 2: 160,311,993 probably benign Het
Gpd2 G A 2: 57,307,083 V217I possibly damaging Het
Hectd4 T C 5: 121,350,431 I3595T probably benign Het
Lmln A G 16: 33,109,856 E561G probably benign Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Man2a2 T A 7: 80,368,838 Y91F probably benign Het
Map4k4 A G 1: 39,988,975 T319A probably damaging Het
Mcm6 G T 1: 128,343,459 H474Q probably damaging Het
Mn1 C G 5: 111,420,667 N834K possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npas2 A G 1: 39,287,566 D44G probably damaging Het
Npc1 C T 18: 12,191,732 G1235R probably damaging Het
Olfml2a C T 2: 38,960,294 T674I probably benign Het
Olfr1311 A G 2: 112,021,767 L29P possibly damaging Het
Plxnb1 C T 9: 109,113,420 A1779V probably benign Het
Ppil3 T A 1: 58,431,322 D123V probably damaging Het
Prr23a3 A G 9: 98,865,137 E48G probably damaging Het
Prr5l T C 2: 101,746,749 E110G probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
R3hdm1 C T 1: 128,221,659 T839M probably benign Het
Rasgrf2 G A 13: 91,885,654 Q544* probably null Het
Riok3 C A 18: 12,148,879 R302S probably damaging Het
Rnf145 A G 11: 44,548,808 K144E probably benign Het
Sin3b A C 8: 72,753,581 T904P probably damaging Het
Skint4 C T 4: 112,119,869 T152M probably damaging Het
Slc22a2 A G 17: 12,610,056 I350V probably benign Het
Slc6a11 G T 6: 114,131,362 G29V probably benign Het
Speg A C 1: 75,391,834 H676P probably damaging Het
St6gal2 T A 17: 55,482,647 H227Q probably damaging Het
Strn3 A G 12: 51,633,621 S399P probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tmem8 A G 17: 26,117,863 R252G possibly damaging Het
Trpm6 T C 19: 18,832,597 L1119P possibly damaging Het
Upf2 A C 2: 6,027,312 T890P unknown Het
Upk1b T A 16: 38,780,107 K170N probably benign Het
Vmn1r78 A T 7: 12,152,558 Y32F probably damaging Het
Vps11 A G 9: 44,361,597 F12S probably damaging Het
Zfp318 T A 17: 46,412,815 C1915S possibly damaging Het
Zfp346 A C 13: 55,113,707 R103S probably damaging Het
Other mutations in Gfra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Gfra1 APN 19 58263905 splice site probably benign
IGL01633:Gfra1 APN 19 58267047 missense probably benign 0.41
IGL02675:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02676:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02677:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02723:Gfra1 APN 19 58453251 missense probably benign 0.00
3-1:Gfra1 UTSW 19 58298567 intron probably benign
R0245:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0652:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0697:Gfra1 UTSW 19 58270123 missense probably benign
R0699:Gfra1 UTSW 19 58270123 missense probably benign
R1344:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1418:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R2001:Gfra1 UTSW 19 58300275 missense probably damaging 1.00
R2866:Gfra1 UTSW 19 58239307 missense possibly damaging 0.93
R3416:Gfra1 UTSW 19 58267112 missense probably damaging 1.00
R4352:Gfra1 UTSW 19 58267024 missense probably benign 0.08
R4727:Gfra1 UTSW 19 58263954 missense probably damaging 0.96
R4755:Gfra1 UTSW 19 58453244 missense probably damaging 1.00
R4914:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4915:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4917:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R5813:Gfra1 UTSW 19 58239255 missense probably benign
R6225:Gfra1 UTSW 19 58238398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAGGTTTCATAGGATCTCAGAG -3'
(R):5'- GGGCTCCTATATTTATCATCTGGC -3'

Sequencing Primer
(F):5'- CTCAGAGTTTCCTAGCATGGAAC -3'
(R):5'- CCCTGCCCTAGACTGTTGATTAATG -3'
Posted On2015-09-24