Incidental Mutation 'R6574:Vmn2r94'
ID523370
Institutional Source Beutler Lab
Gene Symbol Vmn2r94
Ensembl Gene ENSMUSG00000090417
Gene Namevomeronasal 2, receptor 94
SynonymsEG665227
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18240994-18277756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18256159 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 425 (N425K)
Ref Sequence ENSEMBL: ENSMUSP00000156288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172190] [ENSMUST00000231457] [ENSMUST00000231815]
Predicted Effect probably damaging
Transcript: ENSMUST00000172190
AA Change: N425K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126386
Gene: ENSMUSG00000090417
AA Change: N425K

DomainStartEndE-ValueType
Pfam:ANF_receptor 42 425 1.7e-35 PFAM
Pfam:NCD3G 469 522 3.5e-21 PFAM
Pfam:7tm_3 553 790 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231457
Predicted Effect probably damaging
Transcript: ENSMUST00000231815
AA Change: N425K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Vmn2r94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn2r94 APN 17 18257039 missense probably damaging 1.00
IGL01676:Vmn2r94 APN 17 18257010 missense probably benign
IGL01687:Vmn2r94 APN 17 18253312 missense possibly damaging 0.64
IGL02113:Vmn2r94 APN 17 18257675 missense probably damaging 0.99
IGL02408:Vmn2r94 APN 17 18253261 missense probably benign 0.01
IGL02451:Vmn2r94 APN 17 18258191 missense possibly damaging 0.95
IGL02755:Vmn2r94 APN 17 18244499 missense probably benign 0.01
IGL02822:Vmn2r94 APN 17 18243620 missense probably benign 0.00
IGL02868:Vmn2r94 APN 17 18244054 missense possibly damaging 0.75
IGL03008:Vmn2r94 APN 17 18257646 missense probably benign 0.05
R0112:Vmn2r94 UTSW 17 18243604 missense probably benign
R0371:Vmn2r94 UTSW 17 18257294 missense probably benign 0.11
R0413:Vmn2r94 UTSW 17 18243818 missense probably damaging 0.98
R0627:Vmn2r94 UTSW 17 18257165 missense probably damaging 1.00
R0737:Vmn2r94 UTSW 17 18277433 nonsense probably null
R0815:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R0863:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R1125:Vmn2r94 UTSW 17 18257455 missense probably damaging 1.00
R1276:Vmn2r94 UTSW 17 18257082 missense possibly damaging 0.47
R1491:Vmn2r94 UTSW 17 18257703 missense probably damaging 1.00
R1500:Vmn2r94 UTSW 17 18256980 missense probably benign 0.07
R1610:Vmn2r94 UTSW 17 18243733 missense probably damaging 1.00
R1664:Vmn2r94 UTSW 17 18244144 missense probably damaging 0.99
R1716:Vmn2r94 UTSW 17 18257373 missense probably benign 0.01
R1843:Vmn2r94 UTSW 17 18244470 missense probably benign 0.01
R1882:Vmn2r94 UTSW 17 18244214 missense probably benign 0.07
R1936:Vmn2r94 UTSW 17 18244292 nonsense probably null
R2273:Vmn2r94 UTSW 17 18257331 missense probably benign 0.00
R2508:Vmn2r94 UTSW 17 18257474 missense probably benign 0.32
R3436:Vmn2r94 UTSW 17 18258388 splice site probably benign
R3917:Vmn2r94 UTSW 17 18244358 missense probably benign
R3968:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R3969:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R4257:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R4271:Vmn2r94 UTSW 17 18243678 missense probably damaging 1.00
R4349:Vmn2r94 UTSW 17 18244343 missense probably benign 0.01
R4436:Vmn2r94 UTSW 17 18258383 missense probably damaging 1.00
R4603:Vmn2r94 UTSW 17 18257385 missense probably benign 0.33
R4821:Vmn2r94 UTSW 17 18257031 missense probably benign 0.02
R5288:Vmn2r94 UTSW 17 18244466 missense probably damaging 1.00
R5725:Vmn2r94 UTSW 17 18256227 missense possibly damaging 0.88
R5735:Vmn2r94 UTSW 17 18243804 missense probably damaging 1.00
R6066:Vmn2r94 UTSW 17 18257433 missense probably damaging 0.99
R6124:Vmn2r94 UTSW 17 18244059 missense probably benign 0.01
R6189:Vmn2r94 UTSW 17 18257734 missense probably benign 0.25
R6245:Vmn2r94 UTSW 17 18258123 missense probably damaging 1.00
R7236:Vmn2r94 UTSW 17 18257549 missense possibly damaging 0.49
R7317:Vmn2r94 UTSW 17 18243620 missense probably benign 0.00
R7398:Vmn2r94 UTSW 17 18257341 missense probably benign 0.00
R7399:Vmn2r94 UTSW 17 18244503 critical splice acceptor site probably null
R7478:Vmn2r94 UTSW 17 18257505 missense probably benign
X0011:Vmn2r94 UTSW 17 18244448 missense possibly damaging 0.76
X0028:Vmn2r94 UTSW 17 18243975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTGTAATGGAACTTGAGTC -3'
(R):5'- GAACACTCAGGTTTTCACTTAGACATC -3'

Sequencing Primer
(F):5'- CCTCTGAAAATATTTCTGGCC -3'
(R):5'- CTTGGGCACAATGTAGGA -3'
Posted On2018-06-22