Incidental Mutation 'R4846:9930012K11Rik'
ID372189
Institutional Source Beutler Lab
Gene Symbol 9930012K11Rik
Ensembl Gene ENSMUSG00000044551
Gene NameRIKEN cDNA 9930012K11 gene
Synonyms
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70154405-70159502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70155943 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 299 (H299L)
Ref Sequence ENSEMBL: ENSMUSP00000122309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035612] [ENSMUST00000058240] [ENSMUST00000129767] [ENSMUST00000153871]
Predicted Effect probably benign
Transcript: ENSMUST00000035612
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058240
AA Change: H300L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061834
Gene: ENSMUSG00000044551
AA Change: H300L

DomainStartEndE-ValueType
Pfam:DUF4657 78 366 1e-142 PFAM
Predicted Effect silent
Transcript: ENSMUST00000129767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140314
Predicted Effect probably damaging
Transcript: ENSMUST00000153871
AA Change: H299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122309
Gene: ENSMUSG00000044551
AA Change: H299L

DomainStartEndE-ValueType
Pfam:DUF4657 78 365 1.4e-132 PFAM
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in 9930012K11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:9930012K11Rik APN 14 70157607 missense probably benign 0.21
IGL03226:9930012K11Rik APN 14 70157609 missense probably damaging 0.97
R0125:9930012K11Rik UTSW 14 70156647 splice site probably benign
R0544:9930012K11Rik UTSW 14 70157314 missense probably benign 0.00
R1630:9930012K11Rik UTSW 14 70157180 missense probably benign 0.17
R4546:9930012K11Rik UTSW 14 70156478 missense probably benign 0.22
R4822:9930012K11Rik UTSW 14 70156458 missense probably benign 0.12
R5211:9930012K11Rik UTSW 14 70156784 missense probably benign 0.00
R6860:9930012K11Rik UTSW 14 70157622 missense possibly damaging 0.74
R7286:9930012K11Rik UTSW 14 70157237 missense possibly damaging 0.77
R7319:9930012K11Rik UTSW 14 70156186 missense probably benign
X0064:9930012K11Rik UTSW 14 70156772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATCTTAACTACAAGACAGGAC -3'
(R):5'- CCAGGAACCCAAGGTAGTGATG -3'

Sequencing Primer
(F):5'- TCTTAACTACAAGACAGGACACTAC -3'
(R):5'- CCCAAGGTAGTGATGGATATATGTG -3'
Posted On2016-03-01