Incidental Mutation 'IGL03046:Acad12'
ID391851
Institutional Source Beutler Lab
Gene Symbol Acad12
Ensembl Gene ENSMUSG00000042647
Gene Nameacyl-Coenzyme A dehydrogenase family, member 12
Synonyms9330129D05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #IGL03046 (G1)
Quality Score204
Status Validated
Chromosome5
Chromosomal Location121596775-121618938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121609966 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 130 (V130L)
Ref Sequence ENSEMBL: ENSMUSP00000107406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041252] [ENSMUST00000111776] [ENSMUST00000197916]
Predicted Effect probably benign
Transcript: ENSMUST00000041252
AA Change: V130L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046497
Gene: ENSMUSG00000042647
AA Change: V130L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 7e-16 PFAM
Pfam:Acyl-CoA_dh_M 282 383 1.9e-18 PFAM
Pfam:Acyl-CoA_dh_1 395 536 1.5e-27 PFAM
Pfam:Acyl-CoA_dh_2 411 526 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111776
AA Change: V130L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107406
Gene: ENSMUSG00000042647
AA Change: V130L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 1.9e-15 PFAM
Pfam:Acyl-CoA_dh_M 282 336 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131338
SMART Domains Protein: ENSMUSP00000121904
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
PDB:2WBI|B 2 92 2e-26 PDB
SCOP:d1is2a3 3 58 3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197916
SMART Domains Protein: ENSMUSP00000142370
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1j97a_ 40 67 1e-2 SMART
Meta Mutation Damage Score 0.1648 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Acad12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Acad12 APN 5 121604253 unclassified probably benign
IGL02968:Acad12 APN 5 121610038 missense probably benign 0.17
R0085:Acad12 UTSW 5 121604294 missense possibly damaging 0.85
R0538:Acad12 UTSW 5 121607448 missense possibly damaging 0.85
R1424:Acad12 UTSW 5 121604322 missense probably benign 0.01
R1754:Acad12 UTSW 5 121607481 missense probably benign 0.08
R1975:Acad12 UTSW 5 121604259 missense probably benign
R3916:Acad12 UTSW 5 121599214 missense probably damaging 1.00
R3917:Acad12 UTSW 5 121599214 missense probably damaging 1.00
R4531:Acad12 UTSW 5 121598899 missense probably benign
R4531:Acad12 UTSW 5 121598901 missense probably benign
R4676:Acad12 UTSW 5 121607171 missense probably damaging 1.00
R5057:Acad12 UTSW 5 121610089 missense probably benign 0.00
R5166:Acad12 UTSW 5 121600020 missense probably benign 0.04
R5286:Acad12 UTSW 5 121604295 missense probably benign 0.27
R5641:Acad12 UTSW 5 121604021 unclassified probably benign
R5716:Acad12 UTSW 5 121609983 missense probably benign 0.00
R5761:Acad12 UTSW 5 121604180 unclassified probably benign
R6006:Acad12 UTSW 5 121599236 missense possibly damaging 0.46
R6256:Acad12 UTSW 5 121614086 missense probably benign 0.05
R6729:Acad12 UTSW 5 121607935 missense probably damaging 1.00
R6785:Acad12 UTSW 5 121609845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTATCAGCGGGGAAGG -3'
(R):5'- TTCTCCATAGGCCAGGCAAG -3'

Sequencing Primer
(F):5'- GAAGGGCTCCACCTGTTG -3'
(R):5'- CATAGGCCAGGCAAGCTCAG -3'
Posted On2016-06-07