Incidental Mutation 'IGL03046:Xpc'
ID391854
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Namexeroderma pigmentosum, complementation group C
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #IGL03046 (G1)
Quality Score206
Status Validated
Chromosome6
Chromosomal Location91489305-91515888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91510481 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 89 (A89E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000206476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032182
AA Change: A91E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094
AA Change: A91E

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150279
AA Change: A89E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206476
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91492264 unclassified probably benign
IGL01108:Xpc APN 6 91493005 missense probably damaging 1.00
IGL01310:Xpc APN 6 91490107 missense probably benign 0.02
IGL01323:Xpc APN 6 91492353 missense probably damaging 1.00
IGL01350:Xpc APN 6 91500011 missense probably benign 0.01
IGL01656:Xpc APN 6 91505467 missense probably damaging 0.98
IGL01922:Xpc APN 6 91505425 missense probably damaging 1.00
IGL02412:Xpc APN 6 91499785 missense probably benign 0.01
IGL02448:Xpc APN 6 91515744 missense probably benign 0.00
IGL02571:Xpc APN 6 91504071 missense probably benign 0.00
IGL02937:Xpc APN 6 91500137 missense probably damaging 1.00
IGL02951:Xpc APN 6 91506849 missense probably damaging 1.00
IGL03033:Xpc APN 6 91491315 splice site probably null
IGL03248:Xpc APN 6 91504583 missense probably damaging 0.99
R0031:Xpc UTSW 6 91491226 missense probably benign 0.01
R0173:Xpc UTSW 6 91504735 unclassified probably benign
R0285:Xpc UTSW 6 91498064 missense probably damaging 0.99
R0454:Xpc UTSW 6 91491226 missense probably benign 0.01
R0535:Xpc UTSW 6 91504578 missense possibly damaging 0.92
R0554:Xpc UTSW 6 91491226 missense probably benign 0.01
R0759:Xpc UTSW 6 91498142 missense probably damaging 0.99
R1426:Xpc UTSW 6 91493238 missense probably damaging 1.00
R1478:Xpc UTSW 6 91508528 missense possibly damaging 0.94
R1676:Xpc UTSW 6 91492947 missense possibly damaging 0.56
R1969:Xpc UTSW 6 91501025 splice site probably null
R2138:Xpc UTSW 6 91498122 nonsense probably null
R2237:Xpc UTSW 6 91498108 missense probably damaging 1.00
R4580:Xpc UTSW 6 91500011 missense probably benign 0.01
R5318:Xpc UTSW 6 91493010 missense probably damaging 1.00
R5567:Xpc UTSW 6 91498135 missense probably damaging 1.00
R5681:Xpc UTSW 6 91504120 missense probably damaging 1.00
R6022:Xpc UTSW 6 91499636 missense probably damaging 0.96
R6791:Xpc UTSW 6 91506857 missense probably benign 0.01
R6794:Xpc UTSW 6 91506857 missense probably benign 0.01
R6983:Xpc UTSW 6 91504023 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCCATTGAACTCATCAGAAAC -3'
(R):5'- CTTGCCCATAAGTCACACCG -3'

Sequencing Primer
(F):5'- TTGAACTCATCAGAAACTGAGGC -3'
(R):5'- GTTGTCACCCAGATGACTTTGAAG -3'
Posted On2016-06-07