Incidental Mutation 'IGL03046:Usp25'
ID391882
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Nameubiquitin specific peptidase 25
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #IGL03046 (G1)
Quality Score106
Status Validated
Chromosome16
Chromosomal Location77013706-77116780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77074866 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 363 (F363S)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
PDB Structure
Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000023580
AA Change: F363S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: F363S

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 77062405 missense probably damaging 1.00
IGL01359:Usp25 APN 16 77059253 missense probably damaging 1.00
IGL01380:Usp25 APN 16 77093678 missense probably benign 0.06
IGL01614:Usp25 APN 16 77077117 missense probably damaging 1.00
IGL02065:Usp25 APN 16 77083782 missense probably benign 0.06
IGL02271:Usp25 APN 16 77115447 missense probably damaging 1.00
IGL03184:Usp25 APN 16 77081653 missense probably damaging 1.00
R0433:Usp25 UTSW 16 77109217 missense probably benign 0.02
R0741:Usp25 UTSW 16 77071708 missense possibly damaging 0.80
R0944:Usp25 UTSW 16 77081447 splice site probably benign
R1324:Usp25 UTSW 16 77080387 missense probably damaging 0.98
R1341:Usp25 UTSW 16 77115443 missense probably benign
R1373:Usp25 UTSW 16 77062385 splice site probably benign
R1641:Usp25 UTSW 16 77071671 missense possibly damaging 0.89
R1777:Usp25 UTSW 16 77081554 missense probably damaging 1.00
R1813:Usp25 UTSW 16 77114950 missense probably benign 0.00
R1960:Usp25 UTSW 16 77076371 missense probably damaging 1.00
R2256:Usp25 UTSW 16 77113794 missense probably benign
R2271:Usp25 UTSW 16 77076429 missense probably damaging 0.97
R4404:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4408:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4502:Usp25 UTSW 16 77115396 missense probably damaging 1.00
R4604:Usp25 UTSW 16 77115415 missense probably damaging 1.00
R4612:Usp25 UTSW 16 77033945 missense possibly damaging 0.92
R4744:Usp25 UTSW 16 77114989 missense probably damaging 1.00
R4867:Usp25 UTSW 16 77050467 missense probably damaging 1.00
R4932:Usp25 UTSW 16 77033982 critical splice donor site probably null
R5087:Usp25 UTSW 16 77077119 missense probably benign 0.00
R5165:Usp25 UTSW 16 77076405 missense possibly damaging 0.85
R5184:Usp25 UTSW 16 77109227 missense probably benign 0.00
R5307:Usp25 UTSW 16 77093706 missense probably benign
R5331:Usp25 UTSW 16 77050558 missense probably damaging 1.00
R5355:Usp25 UTSW 16 77050454 missense probably damaging 1.00
R5479:Usp25 UTSW 16 77107913 missense possibly damaging 0.51
R5619:Usp25 UTSW 16 77033945 missense probably benign 0.22
R5646:Usp25 UTSW 16 77050472 missense probably benign 0.34
R5946:Usp25 UTSW 16 77115054 nonsense probably null
R6013:Usp25 UTSW 16 77077021 missense probably benign 0.00
R6418:Usp25 UTSW 16 77062442 missense probably damaging 1.00
R6653:Usp25 UTSW 16 77059288 missense probably benign 0.29
R6709:Usp25 UTSW 16 77083932 missense probably benign
R6987:Usp25 UTSW 16 77077180 missense probably damaging 1.00
X0065:Usp25 UTSW 16 77081556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGTAGATAAGGTTTCCCTC -3'
(R):5'- GCATCAATAAACCTTAGCTTCAAGG -3'

Sequencing Primer
(F):5'- TCCTCTGATGTGGACAAAGGC -3'
(R):5'- AGCTTCAAGGAAATAACAATTTTCAC -3'
Posted On2016-06-07