Incidental Mutation 'R5158:Myom3'
ID396824
Institutional Source Beutler Lab
Gene Symbol Myom3
Ensembl Gene ENSMUSG00000037139
Gene Namemyomesin family, member 3
Synonyms8430427K15Rik
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135759715-135815564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135765586 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 149 (C149S)
Ref Sequence ENSEMBL: ENSMUSP00000101480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105854]
Predicted Effect probably damaging
Transcript: ENSMUST00000105854
AA Change: C149S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101480
Gene: ENSMUSG00000037139
AA Change: C149S

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 53 83 N/A INTRINSIC
coiled coil region 119 150 N/A INTRINSIC
IG 160 248 7.64e-9 SMART
IG 277 364 1.37e-1 SMART
FN3 374 457 4.8e-13 SMART
FN3 502 585 9.99e-11 SMART
FN3 603 684 1.74e-10 SMART
FN3 702 785 2.5e-11 SMART
FN3 804 887 7.73e-17 SMART
Blast:IG_like 904 1098 1e-100 BLAST
PDB:2JTD|A 1000 1105 4e-25 PDB
low complexity region 1107 1119 N/A INTRINSIC
IG 1127 1209 4.46e-1 SMART
IGc2 1349 1416 1.4e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Myom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Myom3 APN 4 135762571 missense possibly damaging 0.66
IGL01490:Myom3 APN 4 135810778 missense possibly damaging 0.79
IGL01931:Myom3 APN 4 135789639 missense probably benign 0.05
IGL01935:Myom3 APN 4 135788381 missense probably damaging 1.00
IGL01939:Myom3 APN 4 135765589 missense possibly damaging 0.95
IGL01981:Myom3 APN 4 135785849 nonsense probably null
IGL01985:Myom3 APN 4 135765702 critical splice donor site probably null
IGL02043:Myom3 APN 4 135770675 missense probably damaging 1.00
IGL02477:Myom3 APN 4 135779368 missense probably benign 0.22
IGL02733:Myom3 APN 4 135814303 nonsense probably null
IGL03253:Myom3 APN 4 135783097 missense possibly damaging 0.85
R0359:Myom3 UTSW 4 135778143 missense probably damaging 1.00
R0525:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0665:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0668:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0690:Myom3 UTSW 4 135788426 splice site probably benign
R1235:Myom3 UTSW 4 135789543 missense probably benign 0.09
R1692:Myom3 UTSW 4 135775551 missense probably benign 0.00
R1793:Myom3 UTSW 4 135810755 missense probably benign 0.42
R1859:Myom3 UTSW 4 135779396 missense probably benign 0.01
R1863:Myom3 UTSW 4 135778037 missense probably benign
R1876:Myom3 UTSW 4 135779400 missense probably benign 0.01
R2103:Myom3 UTSW 4 135776412 missense probably benign 0.05
R2152:Myom3 UTSW 4 135803233 missense probably benign 0.05
R4633:Myom3 UTSW 4 135775699 missense probably benign 0.00
R4726:Myom3 UTSW 4 135807275 splice site probably null
R4884:Myom3 UTSW 4 135783055 missense possibly damaging 0.90
R4943:Myom3 UTSW 4 135814274 missense possibly damaging 0.73
R5040:Myom3 UTSW 4 135789659 missense probably damaging 1.00
R5151:Myom3 UTSW 4 135789572 missense probably benign 0.01
R5169:Myom3 UTSW 4 135775578 missense probably benign 0.01
R5239:Myom3 UTSW 4 135800992 splice site probably benign
R6130:Myom3 UTSW 4 135762571 missense probably benign
R6253:Myom3 UTSW 4 135785892 missense probably benign 0.07
R6253:Myom3 UTSW 4 135801003 missense probably benign 0.00
R6331:Myom3 UTSW 4 135776377 missense possibly damaging 0.46
R6346:Myom3 UTSW 4 135806051 missense probably benign 0.00
R6502:Myom3 UTSW 4 135762513 start gained probably benign
R6613:Myom3 UTSW 4 135812459 missense possibly damaging 0.80
R6899:Myom3 UTSW 4 135803292 missense probably damaging 1.00
R6969:Myom3 UTSW 4 135801060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGCACAGTCCTTGACCAC -3'
(R):5'- TATGGCCTTGCTGAGACAGAGG -3'

Sequencing Primer
(F):5'- CAGTCCTTGACCACTGAGC -3'
(R):5'- AACCTTGGGTGAAGATGCCC -3'
Posted On2016-06-21