Incidental Mutation 'R5163:Fnbp1l'
ID397087
Institutional Source Beutler Lab
Gene Symbol Fnbp1l
Ensembl Gene ENSMUSG00000039735
Gene Nameformin binding protein 1-like
SynonymsTOCA1, 2610318I01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122538719-122619715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122544663 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 511 (N511S)
Ref Sequence ENSEMBL: ENSMUSP00000124947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162409] [ENSMUST00000162947]
Predicted Effect probably benign
Transcript: ENSMUST00000162409
AA Change: N453S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124439
Gene: ENSMUSG00000039735
AA Change: N453S

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
PDB:2KE4|A 331 426 3e-30 PDB
low complexity region 468 477 N/A INTRINSIC
SH3 483 540 5.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162947
AA Change: N511S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124947
Gene: ENSMUSG00000039735
AA Change: N511S

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PDB:2KE4|A 389 484 4e-30 PDB
low complexity region 526 535 N/A INTRINSIC
SH3 541 598 5.27e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196051
Predicted Effect unknown
Transcript: ENSMUST00000197259
AA Change: N356S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197342
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Fnbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Fnbp1l APN 3 122549249 missense possibly damaging 0.81
IGL01655:Fnbp1l APN 3 122568749 splice site probably null
IGL01750:Fnbp1l APN 3 122544677 nonsense probably null
IGL02040:Fnbp1l APN 3 122570953 splice site probably benign
IGL02187:Fnbp1l APN 3 122568800 nonsense probably null
IGL03334:Fnbp1l APN 3 122557949 missense probably benign 0.00
R0347:Fnbp1l UTSW 3 122590175 missense probably damaging 1.00
R0382:Fnbp1l UTSW 3 122570953 splice site probably benign
R1401:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R1746:Fnbp1l UTSW 3 122556491 missense probably benign
R1778:Fnbp1l UTSW 3 122590147 missense possibly damaging 0.89
R1861:Fnbp1l UTSW 3 122560932 missense probably damaging 1.00
R2202:Fnbp1l UTSW 3 122546962 missense probably benign 0.00
R3407:Fnbp1l UTSW 3 122552150 missense probably damaging 1.00
R3434:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R3947:Fnbp1l UTSW 3 122544579 missense possibly damaging 0.78
R4667:Fnbp1l UTSW 3 122556567 missense probably benign 0.04
R4771:Fnbp1l UTSW 3 122558103 missense possibly damaging 0.54
R4858:Fnbp1l UTSW 3 122546315 missense probably benign 0.30
R6151:Fnbp1l UTSW 3 122570930 missense possibly damaging 0.89
R6153:Fnbp1l UTSW 3 122559156 missense probably benign 0.01
R6452:Fnbp1l UTSW 3 122544549 missense probably damaging 1.00
R6458:Fnbp1l UTSW 3 122556440 missense probably damaging 0.96
R6788:Fnbp1l UTSW 3 122546307 nonsense probably null
R7397:Fnbp1l UTSW 3 122544637 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCTTTTCTGAGGAGGAAGGG -3'
(R):5'- GAATTACCACATTCAGTCTGCATAG -3'

Sequencing Primer
(F):5'- ACAGACTAGAGAGGAAGCCATC -3'
(R):5'- CCACATTCAGTCTGCATAGTTAATG -3'
Posted On2016-06-21