Incidental Mutation 'R5163:Mettl14'
ID397088
Institutional Source Beutler Lab
Gene Symbol Mettl14
Ensembl Gene ENSMUSG00000028114
Gene Namemethyltransferase like 14
SynonymsG430022H21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123368297-123386108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123374825 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 189 (I189V)
Ref Sequence ENSEMBL: ENSMUSP00000087848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029759] [ENSMUST00000090371] [ENSMUST00000174006] [ENSMUST00000174323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029759
AA Change: I189V

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029759
Gene: ENSMUSG00000028114
AA Change: I189V

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
coiled coil region 65 90 N/A INTRINSIC
Pfam:MT-A70 186 363 2.7e-66 PFAM
low complexity region 397 406 N/A INTRINSIC
low complexity region 408 452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090371
AA Change: I189V

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087848
Gene: ENSMUSG00000028114
AA Change: I189V

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
coiled coil region 65 90 N/A INTRINSIC
Pfam:MT-A70 186 289 3e-33 PFAM
low complexity region 310 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172687
AA Change: *223W
Predicted Effect probably benign
Transcript: ENSMUST00000174006
AA Change: I3V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133741
Gene: ENSMUSG00000028114
AA Change: I3V

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MT-A70 28 146 6e-45 PFAM
low complexity region 180 189 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174323
AA Change: I189V

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134198
Gene: ENSMUSG00000028114
AA Change: I189V

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
coiled coil region 65 90 N/A INTRINSIC
Pfam:MT-A70 186 360 7.3e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Mettl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Mettl14 APN 3 123371339 missense probably damaging 1.00
IGL00846:Mettl14 APN 3 123371363 missense probably damaging 1.00
IGL01614:Mettl14 APN 3 123373960 splice site probably benign
IGL02219:Mettl14 APN 3 123374891 splice site probably benign
IGL02960:Mettl14 APN 3 123374885 missense probably damaging 1.00
R0147:Mettl14 UTSW 3 123371394 missense probably damaging 1.00
R0148:Mettl14 UTSW 3 123371394 missense probably damaging 1.00
R0266:Mettl14 UTSW 3 123382826 missense probably benign 0.05
R0468:Mettl14 UTSW 3 123371412 missense probably damaging 1.00
R0543:Mettl14 UTSW 3 123374762 missense possibly damaging 0.65
R1181:Mettl14 UTSW 3 123374002 missense probably damaging 1.00
R1463:Mettl14 UTSW 3 123374073 splice site probably benign
R4256:Mettl14 UTSW 3 123383605 missense probably damaging 1.00
R4679:Mettl14 UTSW 3 123369414 utr 3 prime probably benign
R4845:Mettl14 UTSW 3 123371355 missense probably damaging 1.00
R6476:Mettl14 UTSW 3 123374037 missense probably damaging 1.00
R7499:Mettl14 UTSW 3 123374854 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAGTGTACTCATAACCCCGC -3'
(R):5'- TCTCCATGTCCTAAGGAAGACATTAG -3'

Sequencing Primer
(F):5'- CCGCTTTCTGGACAAATAAGCGTG -3'
(R):5'- AGTCTGCAGTAAACAAAAGATGTAC -3'
Posted On2016-06-21