Incidental Mutation 'R5225:Pygm'
ID402594
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission 042798-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5225 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6389464 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 279 (D279E)
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000113483]
Predicted Effect probably benign
Transcript: ENSMUST00000035269
AA Change: D367E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: D367E

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113483
AA Change: D279E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: D279E

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142755
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 9,008,007 R465* probably null Het
Abcg3 A T 5: 104,966,783 D289E probably damaging Het
Ablim2 G T 5: 35,866,771 probably null Het
Acp1 A T 12: 30,905,079 V36D probably benign Het
Adgrb1 T A 15: 74,577,499 probably benign Het
Akap6 G A 12: 52,886,546 V274I probably damaging Het
Arhgap39 T C 15: 76,725,515 probably benign Het
Bmp1 G A 14: 70,480,165 R789W probably damaging Het
Cfhr2 T A 1: 139,821,782 Y154F possibly damaging Het
Cilp2 T C 8: 69,883,365 Y358C probably damaging Het
Cyp1a2 T A 9: 57,677,233 K513* probably null Het
Dennd4a G T 9: 64,888,928 K745N possibly damaging Het
Dlg1 T A 16: 31,836,267 S542T probably benign Het
Dmbt1 A T 7: 131,094,735 I893F possibly damaging Het
Dnhd1 A T 7: 105,703,923 E2761V possibly damaging Het
F11 T C 8: 45,255,304 T40A probably benign Het
Fam227a T C 15: 79,636,735 D296G possibly damaging Het
Fance C T 17: 28,315,615 probably benign Het
Gaa A G 11: 119,276,843 D149G probably damaging Het
Gapt A G 13: 110,353,988 M47T possibly damaging Het
Gm1110 T C 9: 26,902,478 N202D probably damaging Het
Gm16432 A T 1: 178,148,908 probably benign Het
Gm7535 T C 17: 17,911,547 probably benign Het
Gm973 T A 1: 59,562,700 M491K probably benign Het
Gmnc A G 16: 26,963,945 V27A probably benign Het
Kif27 T C 13: 58,293,101 T1167A possibly damaging Het
Klrg1 T A 6: 122,271,372 *189C probably null Het
Lime1 T A 2: 181,382,847 M98K probably benign Het
Lrp1 C A 10: 127,556,096 A2867S probably benign Het
Lrrd1 G A 5: 3,858,735 S669N probably benign Het
Mmel1 A G 4: 154,891,999 N520S probably damaging Het
Mrpl48 A C 7: 100,549,328 L206V probably damaging Het
Nagpa C T 16: 5,203,732 A52T probably benign Het
Olfr1264 T G 2: 90,021,184 D294A probably benign Het
Olfr98 A G 17: 37,263,028 V212A probably benign Het
Orai2 A G 5: 136,161,501 S71P probably damaging Het
Pcbp1 A T 6: 86,525,227 I230N probably damaging Het
Pcdh15 T C 10: 74,303,154 L349P probably damaging Het
Pcdhb16 T C 18: 37,479,958 V657A probably benign Het
Prdm15 G T 16: 97,808,675 H590N probably damaging Het
Psg18 T C 7: 18,345,949 I442M probably damaging Het
Rrn3 T A 16: 13,792,934 probably null Het
Sass6 T C 3: 116,614,053 S273P possibly damaging Het
Schip1 A G 3: 68,494,937 M116V probably benign Het
Sdc3 G A 4: 130,818,776 V55I unknown Het
Serpinb8 T A 1: 107,597,471 M1K probably null Het
Slc24a5 T C 2: 125,085,819 I346T probably damaging Het
Slc35f3 T A 8: 126,391,107 I335N probably damaging Het
Snapc2 T A 8: 4,255,299 V147E probably damaging Het
Snx2 T C 18: 53,189,712 S56P possibly damaging Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Stk19 A T 17: 34,821,424 probably benign Het
Sulf1 A G 1: 12,841,478 E692G probably benign Het
Tet1 C T 10: 62,838,671 V1209I probably damaging Het
Tln1 T C 4: 43,539,406 T1639A probably benign Het
Tmem135 G T 7: 89,196,127 Y165* probably null Het
Tmprss6 T C 15: 78,452,507 T398A probably damaging Het
Ube4a C T 9: 44,939,960 probably null Het
Vmn1r227 T C 17: 20,735,237 noncoding transcript Het
Wdhd1 T C 14: 47,250,816 S745G probably benign Het
Xylt1 A G 7: 117,592,036 H353R probably damaging Het
Zfp788 A G 7: 41,649,556 T539A probably benign Het
Zfp866 A T 8: 69,765,441 F510I possibly damaging Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGACAAGGTGGGTATC -3'
(R):5'- CATAGGCTTCCTGACTTCAAGGC -3'

Sequencing Primer
(F):5'- TACAGGAGCCATTCTGTCCCAG -3'
(R):5'- CTTCCTGACTTCAAGGCTGGGG -3'
Posted On2016-07-22