Incidental Mutation 'R5437:Acsm3'
ID428423
Institutional Source Beutler Lab
Gene Symbol Acsm3
Ensembl Gene ENSMUSG00000030935
Gene Nameacyl-CoA synthetase medium-chain family member 3
SynonymsSah, Sa
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119760923-119787513 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 119778497 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529]
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154828
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal kidney function and morphology and blood pressure similar to wild-type on either a regular or high salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Acsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Acsm3 APN 7 119784344 missense probably damaging 1.00
IGL01434:Acsm3 APN 7 119781074 unclassified probably benign
IGL01446:Acsm3 APN 7 119778454 missense probably damaging 1.00
IGL01800:Acsm3 APN 7 119774643 missense possibly damaging 0.68
IGL01882:Acsm3 APN 7 119774635 missense probably damaging 0.99
IGL01954:Acsm3 APN 7 119775083 splice site probably benign
PIT4677001:Acsm3 UTSW 7 119775117 missense probably damaging 1.00
PIT4696001:Acsm3 UTSW 7 119784986 splice site probably null
R0422:Acsm3 UTSW 7 119773740 nonsense probably null
R0423:Acsm3 UTSW 7 119777159 missense probably damaging 1.00
R0729:Acsm3 UTSW 7 119783984 utr 3 prime probably benign
R0731:Acsm3 UTSW 7 119768024 nonsense probably null
R0732:Acsm3 UTSW 7 119773834 missense probably benign 0.40
R0744:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R0836:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R1926:Acsm3 UTSW 7 119777136 missense probably damaging 1.00
R2104:Acsm3 UTSW 7 119784304 missense probably benign
R2429:Acsm3 UTSW 7 119768000 missense probably benign
R3940:Acsm3 UTSW 7 119773886 missense probably benign 0.03
R4386:Acsm3 UTSW 7 119773871 missense probably damaging 1.00
R5890:Acsm3 UTSW 7 119775234 missense probably benign
R6278:Acsm3 UTSW 7 119773849 missense probably damaging 1.00
R6350:Acsm3 UTSW 7 119768033 missense probably benign
R6497:Acsm3 UTSW 7 119780749 critical splice acceptor site probably null
R6582:Acsm3 UTSW 7 119779673 missense probably benign
R6670:Acsm3 UTSW 7 119780755 unclassified probably null
R6939:Acsm3 UTSW 7 119778455 missense probably damaging 1.00
R7037:Acsm3 UTSW 7 119768043 missense probably damaging 1.00
R7087:Acsm3 UTSW 7 119774647 missense probably damaging 1.00
R7301:Acsm3 UTSW 7 119777085 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCAGTTTCTGCATTCCATGATGG -3'
(R):5'- CTGCATAGTCACCTACAAAATGTTG -3'

Sequencing Primer
(F):5'- TGTTGACTGAATGCACAATAGACAG -3'
(R):5'- CTTGTAAATGCCCAGAATCC -3'
Posted On2016-09-01