Incidental Mutation 'R5488:Rab40c'
ID430488
Institutional Source Beutler Lab
Gene Symbol Rab40c
Ensembl Gene ENSMUSG00000025730
Gene NameRab40C, member RAS oncogene family
SynonymsRAR3
MMRRC Submission 043049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25882114-25919727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25890669 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 78 (T78I)
Ref Sequence ENSEMBL: ENSMUSP00000130093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000163356] [ENSMUST00000164738] [ENSMUST00000164982] [ENSMUST00000166146] [ENSMUST00000167018] [ENSMUST00000167626] [ENSMUST00000179998]
Predicted Effect probably benign
Transcript: ENSMUST00000026826
AA Change: T78I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730
AA Change: T78I

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164738
AA Change: T78I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130093
Gene: ENSMUSG00000025730
AA Change: T78I

DomainStartEndE-ValueType
Pfam:Arf 5 110 5.2e-7 PFAM
Pfam:Miro 16 111 4.2e-12 PFAM
Pfam:Ras 16 111 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164982
AA Change: T78I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127868
Gene: ENSMUSG00000025730
AA Change: T78I

DomainStartEndE-ValueType
RAB 15 158 5.56e-54 SMART
SOCS 164 207 2.56e-16 SMART
SOCS_box 170 206 9.29e-6 SMART
low complexity region 219 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably benign
Transcript: ENSMUST00000167018
AA Change: T78I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131055
Gene: ENSMUSG00000025730
AA Change: T78I

DomainStartEndE-ValueType
RAB 15 177 1.88e-74 SMART
SOCS 183 226 2.56e-16 SMART
SOCS_box 189 225 9.29e-6 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167626
AA Change: T78I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730
AA Change: T78I

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172168
Predicted Effect probably benign
Transcript: ENSMUST00000179998
AA Change: T78I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730
AA Change: T78I

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Rab40c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Rab40c APN 17 25885085 missense probably damaging 1.00
IGL01793:Rab40c APN 17 25884622 missense probably damaging 1.00
IGL01936:Rab40c APN 17 25884670 missense probably damaging 0.99
R0089:Rab40c UTSW 17 25885148 missense probably damaging 1.00
R0456:Rab40c UTSW 17 25884657 missense possibly damaging 0.68
R0837:Rab40c UTSW 17 25884693 missense probably damaging 1.00
R1547:Rab40c UTSW 17 25883750 missense probably damaging 1.00
R5955:Rab40c UTSW 17 25884657 missense probably damaging 0.98
R7047:Rab40c UTSW 17 25919484 missense probably damaging 0.98
X0028:Rab40c UTSW 17 25890708 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGATGTCCAGATGTCAAAATACTTCAG -3'
(R):5'- AGCCTCCTCCAATTTTACTCATAACAG -3'

Sequencing Primer
(F):5'- ATGTAGCTCAGCCGTTGAAC -3'
(R):5'- CCTTTAATACCAGTGCTTAGGAGGC -3'
Posted On2016-10-05