Incidental Mutation 'R5455:Maml2'
ID432718
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Namemastermind like transcriptional coactivator 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location13297957-13709388 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13705743 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 128 (Y128*)
Ref Sequence ENSEMBL: ENSMUSP00000136866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294] [ENSMUST00000177755]
Predicted Effect probably null
Transcript: ENSMUST00000034401
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925
AA Change: Y128*

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159294
AA Change: Y884*
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: Y884*

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161245
Predicted Effect probably null
Transcript: ENSMUST00000177755
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000136866
Gene: ENSMUSG00000031925
AA Change: Y128*

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2363:Maml2 UTSW 9 13621245 missense probably damaging 1.00
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 unclassified probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13705835 missense possibly damaging 0.59
R6998:Maml2 UTSW 9 13621185 unclassified probably benign
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCTGCAATAAGAGATGTGGTACTG -3'
(R):5'- TGTGAACTGCCAGCAGATCC -3'

Sequencing Primer
(F):5'- CAATAAGAGATGTGGTACTGTCATG -3'
(R):5'- TGCCAGCAGATCCAGCTC -3'
Posted On2016-10-06