Incidental Mutation 'R5611:Mlh3'
ID438041
Institutional Source Beutler Lab
Gene Symbol Mlh3
Ensembl Gene ENSMUSG00000021245
Gene NamemutL homolog 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85234520-85270599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85267445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 656 (T656A)
Ref Sequence ENSEMBL: ENSMUSP00000152840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]
Predicted Effect probably benign
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019378
AA Change: T656A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: T656A

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166821
AA Change: T656A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: T656A

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220854
AA Change: T656A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000223230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Mlh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Mlh3 APN 12 85267929 missense probably benign
IGL01462:Mlh3 APN 12 85266736 missense probably benign
IGL01961:Mlh3 APN 12 85266344 missense probably benign 0.00
IGL02596:Mlh3 APN 12 85240958 critical splice donor site probably null
IGL03008:Mlh3 APN 12 85240851 missense probably benign 0.23
IGL03142:Mlh3 APN 12 85250301 critical splice donor site probably null
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0078:Mlh3 UTSW 12 85268818 missense probably damaging 0.98
R0129:Mlh3 UTSW 12 85266140 splice site probably benign
R0269:Mlh3 UTSW 12 85268405 missense probably benign 0.00
R0393:Mlh3 UTSW 12 85267587 nonsense probably null
R0403:Mlh3 UTSW 12 85268968 missense possibly damaging 0.93
R0409:Mlh3 UTSW 12 85240854 missense possibly damaging 0.95
R0587:Mlh3 UTSW 12 85266419 missense probably benign 0.00
R0701:Mlh3 UTSW 12 85267903 missense probably benign 0.00
R0718:Mlh3 UTSW 12 85247697 missense possibly damaging 0.86
R0883:Mlh3 UTSW 12 85235714 missense possibly damaging 0.89
R0989:Mlh3 UTSW 12 85269395 missense probably benign 0.22
R0990:Mlh3 UTSW 12 85267765 missense probably benign
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1562:Mlh3 UTSW 12 85266920 missense probably benign 0.14
R1599:Mlh3 UTSW 12 85268369 missense probably damaging 1.00
R1694:Mlh3 UTSW 12 85267141 missense probably damaging 1.00
R1777:Mlh3 UTSW 12 85268754 missense possibly damaging 0.75
R1822:Mlh3 UTSW 12 85266145 splice site probably benign
R1874:Mlh3 UTSW 12 85237513 critical splice donor site probably null
R1914:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R1915:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R2075:Mlh3 UTSW 12 85269141 nonsense probably null
R2083:Mlh3 UTSW 12 85269041 missense probably benign 0.16
R2267:Mlh3 UTSW 12 85260811 missense possibly damaging 0.55
R2334:Mlh3 UTSW 12 85268077 missense probably benign 0.00
R2882:Mlh3 UTSW 12 85267566 missense probably damaging 1.00
R3623:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3624:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3963:Mlh3 UTSW 12 85268680 missense possibly damaging 0.94
R4376:Mlh3 UTSW 12 85259198 missense probably benign 0.00
R5334:Mlh3 UTSW 12 85245761 critical splice donor site probably null
R5526:Mlh3 UTSW 12 85269373 nonsense probably null
R5556:Mlh3 UTSW 12 85268493 nonsense probably null
R5911:Mlh3 UTSW 12 85268455 missense probably damaging 1.00
R6050:Mlh3 UTSW 12 85240846 missense possibly damaging 0.89
R6221:Mlh3 UTSW 12 85268418 missense possibly damaging 0.94
R6377:Mlh3 UTSW 12 85268497 missense probably damaging 0.97
R6820:Mlh3 UTSW 12 85247723 missense probably damaging 1.00
R6826:Mlh3 UTSW 12 85245824 missense probably benign 0.38
X0024:Mlh3 UTSW 12 85247669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACACCATGGGAAGGAGG -3'
(R):5'- AAAGGAGCCCAGTAGTCGTG -3'

Sequencing Primer
(F):5'- CATCAGGCAAAAGGCGATCTGTG -3'
(R):5'- CCCAGTAGTCGTGGAAGAGTAAATG -3'
Posted On2016-10-26