Incidental Mutation 'R5726:Foxp4'
ID452527
Institutional Source Beutler Lab
Gene Symbol Foxp4
Ensembl Gene ENSMUSG00000023991
Gene Nameforkhead box P4
Synonyms
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47867133-47924645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47869108 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 623 (Y623H)
Ref Sequence ENSEMBL: ENSMUSP00000108890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097311] [ENSMUST00000113262] [ENSMUST00000113263] [ENSMUST00000113265]
Predicted Effect unknown
Transcript: ENSMUST00000097311
AA Change: Y636H
SMART Domains Protein: ENSMUSP00000094916
Gene: ENSMUSG00000023991
AA Change: Y636H

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 470 552 4.69e-38 SMART
low complexity region 644 658 N/A INTRINSIC
low complexity region 671 683 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113262
AA Change: Y624H
SMART Domains Protein: ENSMUSP00000108887
Gene: ENSMUSG00000023991
AA Change: Y624H

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 458 540 4.69e-38 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 659 671 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113263
AA Change: Y634H
SMART Domains Protein: ENSMUSP00000108888
Gene: ENSMUSG00000023991
AA Change: Y634H

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 171 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
ZnF_C2H2 311 336 3.47e0 SMART
FH 468 550 4.69e-38 SMART
low complexity region 642 656 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113265
AA Change: Y623H
SMART Domains Protein: ENSMUSP00000108890
Gene: ENSMUSG00000023991
AA Change: Y623H

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
internal_repeat_1 214 282 3.94e-5 PROSPERO
low complexity region 296 307 N/A INTRINSIC
ZnF_C2H2 312 337 3.47e0 SMART
FH 457 539 4.69e-38 SMART
internal_repeat_1 571 627 3.94e-5 PROSPERO
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 670 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Many members of the forkhead box gene family, including members of subfamily P, have roles in mammalian oncogenesis. This gene may play a role in the development of tumors of the kidney and larynx. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die before E12.5. Foregut closure is delayed leading to the development of two beating hearts and to the failure of the trachea and esophagus to separate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Foxp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Foxp4 APN 17 47888153 missense probably damaging 1.00
IGL02454:Foxp4 APN 17 47875582 nonsense probably null
IGL03048:Foxp4 UTSW 17 47880840 missense unknown
R0138:Foxp4 UTSW 17 47869179 missense unknown
R1180:Foxp4 UTSW 17 47880353 splice site probably benign
R1268:Foxp4 UTSW 17 47880353 splice site probably benign
R1282:Foxp4 UTSW 17 47875643 missense unknown
R1494:Foxp4 UTSW 17 47880353 splice site probably benign
R1845:Foxp4 UTSW 17 47877959 missense probably null
R1956:Foxp4 UTSW 17 47875871 missense unknown
R1958:Foxp4 UTSW 17 47875871 missense unknown
R1969:Foxp4 UTSW 17 47875871 missense unknown
R1970:Foxp4 UTSW 17 47875871 missense unknown
R1971:Foxp4 UTSW 17 47875871 missense unknown
R2240:Foxp4 UTSW 17 47871276 missense unknown
R3847:Foxp4 UTSW 17 47875528 missense unknown
R3848:Foxp4 UTSW 17 47875528 missense unknown
R3849:Foxp4 UTSW 17 47875528 missense unknown
R4345:Foxp4 UTSW 17 47874648 missense unknown
R5572:Foxp4 UTSW 17 47880879 missense unknown
R6386:Foxp4 UTSW 17 47878462 missense unknown
R6510:Foxp4 UTSW 17 47875410 missense unknown
X0025:Foxp4 UTSW 17 47877965 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGATCTAGAAGGCCAGGG -3'
(R):5'- GGTCTCCAGCCACTGATAAC -3'

Sequencing Primer
(F):5'- CTCTCCAGGCTCTGTGTGG -3'
(R):5'- ACCCCATGTGCTCCAGG -3'
Posted On2017-01-03