Incidental Mutation 'R6119:Sftpa1'
ID485682
Institutional Source Beutler Lab
Gene Symbol Sftpa1
Ensembl Gene ENSMUSG00000021789
Gene Namesurfactant associated protein A1
SynonymsSftp1, surfactant pulmonary associated protein A1, SFTPA1, SP-A, Sftp-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6119 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location41131782-41136452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41132552 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 32 (I32N)
Ref Sequence ENSEMBL: ENSMUSP00000129696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022314] [ENSMUST00000170719]
Predicted Effect probably damaging
Transcript: ENSMUST00000022314
AA Change: I32N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022314
Gene: ENSMUSG00000021789
AA Change: I32N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 42 83 N/A INTRINSIC
CLECT 126 247 3.61e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170719
AA Change: I32N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129696
Gene: ENSMUSG00000021789
AA Change: I32N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 20 66 1.6e-7 PFAM
Pfam:Collagen 65 102 1.9e-7 PFAM
CLECT 126 247 3.61e-17 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired lung response to hyperventilation, reduced resistance to pulmonary infections, and enhanced pulmonary inflammatory response to lipopolysaccharide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,565,713 R97* probably null Het
4930544D05Rik G A 11: 70,616,491 A121T probably damaging Het
Abtb2 A T 2: 103,702,310 E484D probably benign Het
Ankk1 A T 9: 49,426,883 W37R possibly damaging Het
Arhgap11a C A 2: 113,834,350 M529I probably benign Het
Btd G A 14: 31,641,108 probably benign Het
Ddx47 T C 6: 135,023,355 I438T probably benign Het
Dnhd1 A G 7: 105,709,440 T3379A probably benign Het
Dusp3 A G 11: 101,980,669 probably benign Het
Dync1h1 A G 12: 110,628,006 K1289E possibly damaging Het
Egf A T 3: 129,736,772 I247N probably benign Het
Erich1 A G 8: 14,033,692 L126P probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fat3 T A 9: 16,376,568 H553L possibly damaging Het
Gdpgp1 T C 7: 80,238,992 L257P probably damaging Het
Gimap8 T C 6: 48,658,954 I551T possibly damaging Het
Gnptab C A 10: 88,431,395 D449E probably damaging Het
Grb10 T C 11: 11,933,551 D513G probably damaging Het
Grin1 T G 2: 25,305,158 D283A probably damaging Het
Gtf2i A T 5: 134,287,057 probably null Het
Ip6k3 A G 17: 27,148,625 V199A possibly damaging Het
Kif17 T A 4: 138,288,332 Y405* probably null Het
Lair1 T C 7: 4,028,896 M71V probably benign Het
Mamdc2 G A 19: 23,353,315 T376M probably damaging Het
Msra G A 14: 64,440,734 R38C probably damaging Het
Mthfd1 A T 12: 76,303,673 I462F probably damaging Het
Mum1 A G 10: 80,229,031 K32E probably benign Het
Nbr1 A G 11: 101,567,112 probably null Het
Neb A G 2: 52,220,931 M181T probably benign Het
Noxo1 A G 17: 24,696,571 probably benign Het
Olfr1124 A T 2: 87,435,389 K301* probably null Het
Olfr1195 A G 2: 88,683,591 I47T probably damaging Het
Olfr181 A T 16: 58,926,532 I13N possibly damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Optn C A 2: 5,021,323 probably null Het
Pclo A G 5: 14,677,019 probably benign Het
Ppp1r16b A G 2: 158,751,127 I209V probably benign Het
Prss12 A G 3: 123,489,609 I517V possibly damaging Het
Ripor2 C T 13: 24,614,644 probably benign Het
Rmnd5b A G 11: 51,625,709 S274P probably benign Het
Slc2a12 T A 10: 22,665,347 I367N probably damaging Het
Sorcs1 T C 19: 50,288,094 D340G probably damaging Het
Synj1 T C 16: 90,938,989 K1359E probably benign Het
Tcf12 T A 9: 71,868,265 E421V probably damaging Het
Tecta A T 9: 42,373,075 F905I probably benign Het
Tmem106a T A 11: 101,583,750 C58* probably null Het
Tmem131l A T 3: 83,898,382 F1585I probably damaging Het
Tnks2 T C 19: 36,879,352 S208P possibly damaging Het
Trim50 A G 5: 135,353,420 N42S probably benign Het
Tsc22d2 T A 3: 58,460,253 probably benign Het
Ttll3 T A 6: 113,394,741 L23H probably damaging Het
Vmn1r10 A G 6: 57,114,233 Y270C probably benign Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp677 A G 17: 21,397,808 T376A possibly damaging Het
Other mutations in Sftpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sftpa1 APN 14 41132570 missense probably benign 0.10
R1072:Sftpa1 UTSW 14 41133635 splice site probably null
R1836:Sftpa1 UTSW 14 41132846 missense possibly damaging 0.82
R2183:Sftpa1 UTSW 14 41132866 missense probably damaging 1.00
R4941:Sftpa1 UTSW 14 41132552 missense probably damaging 0.99
R5152:Sftpa1 UTSW 14 41134352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCTGGGTCCTGCAAAG -3'
(R):5'- AAGACACATGCTCTAGCCCG -3'

Sequencing Primer
(F):5'- CCTGGGTCCTGCAAAGTGTAG -3'
(R):5'- ATGCTCTAGCCCGAGGACTC -3'
Posted On2017-08-16