Mutagenetix > Incidental Mutation

Incidental Mutation 'R6631:Trrap'

525114

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

044753-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6631 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144704547-144796588 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144708460 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 48 (N48S)

Ref Sequence

ENSEMBL: ENSMUSP00000115917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000128550] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038980
AA Change: N48S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: N48S

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094120
AA Change: N48S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: N48S

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100467
AA Change: N48S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: N48S

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128550
AA Change: N48S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158060

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197741

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213013
AA Change: N48S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.1052

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	A	T	9: 15,203,326 (GRCm39)	N159K	probably damaging	Het
Arhgef10l	T	C	4: 140,245,058 (GRCm39)		probably benign	Het
Atosa	A	G	9: 74,861,107 (GRCm39)	D4G	possibly damaging	Het
Avil	A	G	10: 126,843,618 (GRCm39)	S153G	possibly damaging	Het
C2cd3	G	A	7: 100,067,747 (GRCm39)	D877N	probably damaging	Het
Clca3a2	G	A	3: 144,519,405 (GRCm39)	A257V	probably benign	Het
Cramp1	T	A	17: 25,202,931 (GRCm39)	H366L	probably benign	Het
Cyp2c37	C	T	19: 39,998,287 (GRCm39)	S393L	probably damaging	Het
Defb8	T	A	8: 19,495,950 (GRCm39)	I37L	probably benign	Het
Dennd4b	C	A	3: 90,185,039 (GRCm39)		probably null	Het
Eps8l2	G	A	7: 140,936,115 (GRCm39)	R223H	probably damaging	Het
Erbin	A	G	13: 103,961,400 (GRCm39)	L1302P	probably benign	Het
Exoc3l	A	G	8: 106,021,993 (GRCm39)	W37R	probably damaging	Het
Fap	T	C	2: 62,333,725 (GRCm39)	N668S	probably damaging	Het
Gas7	A	G	11: 67,565,107 (GRCm39)	N250S	probably damaging	Het
H2bc12	T	A	13: 22,220,391 (GRCm39)	V112E	probably damaging	Het
Hivep1	C	A	13: 42,309,956 (GRCm39)	P732Q	probably damaging	Het
Irx4	G	T	13: 73,416,545 (GRCm39)	A314S	probably benign	Het
Itgb8	A	T	12: 119,144,712 (GRCm39)	L332*	probably null	Het
Kctd19	A	G	8: 106,111,960 (GRCm39)		probably null	Het
Kif14	G	A	1: 136,443,697 (GRCm39)	S1290N	probably benign	Het
Klk1b3	C	T	7: 43,850,888 (GRCm39)	T140I	probably benign	Het
Lama1	A	G	17: 68,081,477 (GRCm39)	N1305D	probably benign	Het
Lrp1	A	T	10: 127,410,201 (GRCm39)	V1515E	probably damaging	Het
Man2b1	A	G	8: 85,813,440 (GRCm39)		probably null	Het
Mocos	A	G	18: 24,832,988 (GRCm39)	T818A	probably benign	Het
Mpc2	G	T	1: 165,307,081 (GRCm39)	W94L	probably benign	Het
Mrc1	G	A	2: 14,243,296 (GRCm39)	V141I	probably benign	Het
Nalcn	T	C	14: 123,697,663 (GRCm39)	T538A	probably benign	Het
Ndufs3	G	A	2: 90,732,744 (GRCm39)	T114M	probably damaging	Het
Noct	T	C	3: 51,157,621 (GRCm39)	C320R	probably damaging	Het
Or5b117	T	A	19: 13,431,185 (GRCm39)	Q232L	probably benign	Het
Pcdha11	G	T	18: 37,138,844 (GRCm39)	A158S	probably damaging	Het
Pcdhga8	T	A	18: 37,860,109 (GRCm39)	D388E	probably benign	Het
Peg3	T	C	7: 6,712,069 (GRCm39)	E1051G	possibly damaging	Het
Phlda2	T	A	7: 143,055,918 (GRCm39)	I104F	probably damaging	Het
Polr2a	A	G	11: 69,626,339 (GRCm39)	S1604P	possibly damaging	Het
Pomt2	C	T	12: 87,186,417 (GRCm39)		probably null	Het
Ppp6r2	G	A	15: 89,137,458 (GRCm39)		probably null	Het
Prdm2	T	G	4: 142,861,454 (GRCm39)	Q612P	probably benign	Het
Prr5	C	A	15: 84,586,978 (GRCm39)	R243S	probably damaging	Het
Ptgdr2	T	C	19: 10,918,233 (GRCm39)	I250T	probably benign	Het
Rad54l2	A	T	9: 106,590,739 (GRCm39)	C462*	probably null	Het
Sec16a	T	A	2: 26,329,969 (GRCm39)	E682V	probably damaging	Het
Serpina3i	A	G	12: 104,232,725 (GRCm39)	D210G	probably damaging	Het
Slain2	T	A	5: 73,114,748 (GRCm39)	D326E	probably benign	Het
Sned1	A	G	1: 93,209,374 (GRCm39)	E829G	probably damaging	Het
Steap4	G	A	5: 8,026,995 (GRCm39)	W319*	probably null	Het
Taar8c	A	G	10: 23,977,701 (GRCm39)	V37A	probably benign	Het
Tdrd12	T	A	7: 35,184,654 (GRCm39)	Y753F	probably damaging	Het
Tnxb	A	G	17: 34,937,222 (GRCm39)	S3770G	probably damaging	Het
Zfp558	C	A	9: 18,368,219 (GRCm39)	G190*	probably null	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144,716,784 (GRCm39)	splice site	probably benign
IGL00470:Trrap	APN	5	144,754,848 (GRCm39)	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144,762,035 (GRCm39)	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144,721,065 (GRCm39)	splice site	probably benign
IGL01087:Trrap	APN	5	144,783,349 (GRCm39)	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144,741,628 (GRCm39)	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144,767,779 (GRCm39)	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144,767,831 (GRCm39)	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144,770,097 (GRCm39)	splice site	probably benign
IGL01748:Trrap	APN	5	144,770,150 (GRCm39)	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144,758,685 (GRCm39)	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144,793,799 (GRCm39)	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144,765,304 (GRCm39)	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144,753,243 (GRCm39)	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144,777,246 (GRCm39)	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144,769,348 (GRCm39)	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144,714,727 (GRCm39)	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144,735,200 (GRCm39)	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144,761,360 (GRCm39)	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144,777,889 (GRCm39)	splice site	probably benign
IGL02953:Trrap	APN	5	144,752,774 (GRCm39)	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144,769,996 (GRCm39)	missense	probably benign	0.00
Buffer	UTSW	5	144,771,014 (GRCm39)	missense	probably benign	0.06
Card-tower	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
Cookie	UTSW	5	144,730,859 (GRCm39)	missense	probably damaging	1.00
Glass_house	UTSW	5	144,782,287 (GRCm39)	missense	possibly damaging	0.67
Immovable	UTSW	5	144,727,665 (GRCm39)	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144,763,527 (GRCm39)	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144,776,424 (GRCm39)	missense	probably benign	0.39
vitreous	UTSW	5	144,742,537 (GRCm39)	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144,733,781 (GRCm39)	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144,765,410 (GRCm39)	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144,719,003 (GRCm39)	splice site	probably benign
R0062:Trrap	UTSW	5	144,719,003 (GRCm39)	splice site	probably benign
R0112:Trrap	UTSW	5	144,759,571 (GRCm39)	nonsense	probably null
R0126:Trrap	UTSW	5	144,742,560 (GRCm39)	nonsense	probably null
R0257:Trrap	UTSW	5	144,741,045 (GRCm39)	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144,753,205 (GRCm39)	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144,753,149 (GRCm39)	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144,751,366 (GRCm39)	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144,776,377 (GRCm39)	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144,783,287 (GRCm39)	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144,790,309 (GRCm39)	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144,751,640 (GRCm39)	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144,742,537 (GRCm39)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144,714,749 (GRCm39)	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144,753,219 (GRCm39)	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144,726,409 (GRCm39)	splice site	probably benign
R1374:Trrap	UTSW	5	144,783,428 (GRCm39)	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144,794,232 (GRCm39)	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144,755,123 (GRCm39)	missense	probably benign
R1538:Trrap	UTSW	5	144,774,012 (GRCm39)	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144,751,385 (GRCm39)	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144,765,400 (GRCm39)	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144,759,513 (GRCm39)	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144,790,396 (GRCm39)	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144,767,761 (GRCm39)	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144,752,727 (GRCm39)	splice site	probably null
R1902:Trrap	UTSW	5	144,752,863 (GRCm39)	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144,752,863 (GRCm39)	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144,790,298 (GRCm39)	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144,739,854 (GRCm39)	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144,765,372 (GRCm39)	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144,719,049 (GRCm39)	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144,762,684 (GRCm39)	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144,781,021 (GRCm39)	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144,758,665 (GRCm39)	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144,754,776 (GRCm39)	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144,780,179 (GRCm39)	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144,729,062 (GRCm39)	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144,728,975 (GRCm39)	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144,780,128 (GRCm39)	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144,767,858 (GRCm39)	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144,762,131 (GRCm39)	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144,728,928 (GRCm39)	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144,722,290 (GRCm39)	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144,753,380 (GRCm39)	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144,753,380 (GRCm39)	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144,740,087 (GRCm39)	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144,769,298 (GRCm39)	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144,737,758 (GRCm39)	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144,782,402 (GRCm39)	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144,742,545 (GRCm39)	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144,742,530 (GRCm39)	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144,793,770 (GRCm39)	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144,763,527 (GRCm39)	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144,787,989 (GRCm39)	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144,754,596 (GRCm39)	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144,750,313 (GRCm39)	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144,781,034 (GRCm39)	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144,786,787 (GRCm39)	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144,719,075 (GRCm39)	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144,767,755 (GRCm39)	missense	probably benign
R5885:Trrap	UTSW	5	144,731,603 (GRCm39)	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144,786,730 (GRCm39)	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144,723,518 (GRCm39)	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144,744,201 (GRCm39)	splice site	silent
R5992:Trrap	UTSW	5	144,746,994 (GRCm39)	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144,781,051 (GRCm39)	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144,762,724 (GRCm39)	missense	possibly damaging	0.75
R6029:Trrap	UTSW	5	144,754,489 (GRCm39)	missense	possibly damaging	0.94
R6117:Trrap	UTSW	5	144,739,771 (GRCm39)	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144,718,791 (GRCm39)	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144,776,523 (GRCm39)	splice site	probably null
R6288:Trrap	UTSW	5	144,748,802 (GRCm39)	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144,741,828 (GRCm39)	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144,750,336 (GRCm39)	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144,727,680 (GRCm39)	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144,720,856 (GRCm39)	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144,793,812 (GRCm39)	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144,771,014 (GRCm39)	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144,752,360 (GRCm39)	critical splice donor site	probably null
R6727:Trrap	UTSW	5	144,793,760 (GRCm39)	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144,788,066 (GRCm39)	nonsense	probably null
R6914:Trrap	UTSW	5	144,720,853 (GRCm39)	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144,720,853 (GRCm39)	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144,727,665 (GRCm39)	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144,728,964 (GRCm39)	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144,733,945 (GRCm39)	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144,739,988 (GRCm39)	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144,758,613 (GRCm39)	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144,776,424 (GRCm39)	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144,730,859 (GRCm39)	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144,779,517 (GRCm39)	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144,733,945 (GRCm39)	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144,795,764 (GRCm39)	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144,782,287 (GRCm39)	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144,751,333 (GRCm39)	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144,726,208 (GRCm39)	missense	probably benign
R7447:Trrap	UTSW	5	144,776,284 (GRCm39)	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144,788,019 (GRCm39)	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144,779,422 (GRCm39)	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144,779,422 (GRCm39)	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144,769,321 (GRCm39)	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144,713,956 (GRCm39)	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144,772,707 (GRCm39)	splice site	probably null
R8183:Trrap	UTSW	5	144,765,343 (GRCm39)	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144,722,344 (GRCm39)	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144,727,975 (GRCm39)	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144,762,747 (GRCm39)	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144,727,842 (GRCm39)	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144,773,949 (GRCm39)	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144,773,949 (GRCm39)	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144,782,348 (GRCm39)	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144,781,021 (GRCm39)	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144,758,649 (GRCm39)	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144,757,063 (GRCm39)	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144,740,162 (GRCm39)	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144,783,226 (GRCm39)	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144,733,961 (GRCm39)	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144,767,830 (GRCm39)	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144,726,362 (GRCm39)	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144,708,049 (GRCm39)	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144,727,925 (GRCm39)	missense	probably benign
R9380:Trrap	UTSW	5	144,769,981 (GRCm39)	missense	probably benign
R9404:Trrap	UTSW	5	144,752,225 (GRCm39)	missense	possibly damaging	0.85
R9457:Trrap	UTSW	5	144,763,478 (GRCm39)	missense	probably damaging	1.00
R9464:Trrap	UTSW	5	144,763,517 (GRCm39)	missense	probably damaging	0.99
R9504:Trrap	UTSW	5	144,742,904 (GRCm39)	missense	probably damaging	1.00
R9583:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9584:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9585:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9608:Trrap	UTSW	5	144,780,128 (GRCm39)	missense	possibly damaging	0.60
R9728:Trrap	UTSW	5	144,726,193 (GRCm39)	missense	probably benign	0.22
R9782:Trrap	UTSW	5	144,758,716 (GRCm39)	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144,780,171 (GRCm39)	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144,771,007 (GRCm39)	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144,756,518 (GRCm39)	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144,747,154 (GRCm39)	missense
Z1177:Trrap	UTSW	5	144,793,761 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTTGTCTGTGCATGCAC -3'
(R):5'- TCCAGAGTTCAATCCCCAGG -3'

Sequencing Primer
(F):5'- GACCTAGCCCTGTGCCATC -3'
(R):5'- CAGGCCCACAACGATGG -3'

Posted On

2018-06-22