Mutagenetix > Incidental Mutation

Incidental Mutation 'R6844:Arhgap21'

534655

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

044950-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.570) question?

Stock #

R6844 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20852730-20973692 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20886116 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 354 (S354P)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114594
AA Change: S358P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: S358P

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298
AA Change: S364P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: S364P

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230
AA Change: S364P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: S364P

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173194
AA Change: S354P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: S354P

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: S193P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: S193P

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap18	G	A	10: 26,648,682 (GRCm39)	A35T	probably benign	Het
Casq2	A	T	3: 102,017,578 (GRCm39)	H86L	possibly damaging	Het
Ccdc188	G	A	16: 18,036,074 (GRCm39)	G83E	probably damaging	Het
Cd22	G	T	7: 30,572,856 (GRCm39)		probably null	Het
Cyp2b13	T	A	7: 25,781,122 (GRCm39)	I178N	probably damaging	Het
Cyp4a31	T	A	4: 115,420,989 (GRCm39)	C26S	probably null	Het
Eif3h	T	C	15: 51,728,729 (GRCm39)	D42G	possibly damaging	Het
Elovl4	T	A	9: 83,672,164 (GRCm39)	I52L	probably benign	Het
Fgfbp3	C	A	19: 36,896,280 (GRCm39)	A113S	possibly damaging	Het
Fsip2	A	T	2: 82,813,969 (GRCm39)	K3429N	possibly damaging	Het
Gemin5	T	C	11: 58,054,730 (GRCm39)	D224G	probably benign	Het
Gm3415	T	C	5: 146,494,811 (GRCm39)	I158T	probably benign	Het
Gpr22	C	A	12: 31,759,951 (GRCm39)	R20L	probably benign	Het
Htr1a	A	G	13: 105,581,455 (GRCm39)	K232E	possibly damaging	Het
Itgax	T	A	7: 127,747,106 (GRCm39)		probably null	Het
Jag2	T	C	12: 112,880,334 (GRCm39)	Y310C	probably damaging	Het
Lce1j	A	G	3: 92,696,656 (GRCm39)	S41P	unknown	Het
Mllt10	A	G	2: 18,164,294 (GRCm39)	I197V	probably benign	Het
Muc5ac	C	T	7: 141,363,481 (GRCm39)		probably benign	Het
Mybpc1	T	A	10: 88,372,243 (GRCm39)	I796F	possibly damaging	Het
Nr2c1	T	A	10: 94,007,029 (GRCm39)	L289*	probably null	Het
Omp	T	A	7: 97,794,283 (GRCm39)	M115L	probably benign	Het
Pdcd1	C	T	1: 93,967,106 (GRCm39)	R264H	probably benign	Het
Plxna2	T	C	1: 194,476,136 (GRCm39)	F1119L	probably benign	Het
Ralyl	A	G	3: 13,841,938 (GRCm39)	T25A	probably damaging	Het
Rapgef4	A	G	2: 72,064,970 (GRCm39)	T656A	probably damaging	Het
Ripor3	C	T	2: 167,835,253 (GRCm39)		probably null	Het
Samd8	T	C	14: 21,825,205 (GRCm39)	S54P	probably damaging	Het
Serpinb9g	A	T	13: 33,670,616 (GRCm39)	I35F	probably damaging	Het
Shisa8	T	C	15: 82,096,310 (GRCm39)	S102G	probably damaging	Het
Slc4a1ap	T	A	5: 31,684,822 (GRCm39)	S153T	probably damaging	Het
Slc4a4	T	A	5: 89,376,831 (GRCm39)	D1028E	probably damaging	Het
Slc6a13	T	A	6: 121,302,012 (GRCm39)	I198N	probably damaging	Het
Sst	C	T	16: 23,708,592 (GRCm39)	D80N	probably benign	Het
Synj2	A	G	17: 6,026,081 (GRCm39)	K47E	probably damaging	Het
Tal1	C	T	4: 114,920,464 (GRCm39)	P46L	probably benign	Het
Top2b	A	T	14: 16,429,383 (GRCm38)	N1541I	possibly damaging	Het
Vps13b	T	A	15: 35,877,736 (GRCm39)	N2903K	probably benign	Het
Zfp949	A	G	9: 88,451,464 (GRCm39)	T345A	possibly damaging	Het
Zmat3	A	G	3: 32,395,644 (GRCm39)	Y288H	probably damaging	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20,860,511 (GRCm39)	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20,854,392 (GRCm39)	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20,919,455 (GRCm39)	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20,854,448 (GRCm39)	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20,884,813 (GRCm39)	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20,885,117 (GRCm39)	missense	probably benign
IGL02264:Arhgap21	APN	2	20,864,850 (GRCm39)	splice site	probably null
IGL02346:Arhgap21	APN	2	20,884,762 (GRCm39)	splice site	probably benign
IGL02418:Arhgap21	APN	2	20,885,711 (GRCm39)	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20,860,399 (GRCm39)	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20,896,902 (GRCm39)	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20,865,874 (GRCm39)	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20,919,532 (GRCm39)	missense	probably benign
IGL03265:Arhgap21	APN	2	20,854,439 (GRCm39)	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20,885,500 (GRCm39)	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20,864,612 (GRCm39)	splice site	probably benign
R0363:Arhgap21	UTSW	2	20,885,944 (GRCm39)	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20,867,928 (GRCm39)	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20,919,610 (GRCm39)	nonsense	probably null
R0633:Arhgap21	UTSW	2	20,860,198 (GRCm39)	nonsense	probably null
R0905:Arhgap21	UTSW	2	20,854,745 (GRCm39)	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20,886,576 (GRCm39)	nonsense	probably null
R1570:Arhgap21	UTSW	2	20,885,651 (GRCm39)	missense	probably benign
R1686:Arhgap21	UTSW	2	20,886,659 (GRCm39)	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20,865,910 (GRCm39)	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20,854,331 (GRCm39)	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20,886,451 (GRCm39)	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20,884,862 (GRCm39)	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20,859,809 (GRCm39)	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20,855,102 (GRCm39)	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20,864,717 (GRCm39)	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20,896,915 (GRCm39)	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20,972,146 (GRCm39)	missense	probably benign
R4686:Arhgap21	UTSW	2	20,868,033 (GRCm39)	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20,854,967 (GRCm39)	missense	probably benign
R4834:Arhgap21	UTSW	2	20,870,130 (GRCm39)	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20,885,998 (GRCm39)	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20,885,279 (GRCm39)	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20,854,872 (GRCm39)	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20,863,800 (GRCm39)	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20,854,701 (GRCm39)	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20,884,848 (GRCm39)	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20,853,645 (GRCm39)	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20,854,127 (GRCm39)	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20,854,533 (GRCm39)	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20,885,897 (GRCm39)	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20,885,497 (GRCm39)	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20,868,024 (GRCm39)	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20,853,852 (GRCm39)	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20,886,187 (GRCm39)	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20,886,616 (GRCm39)	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20,885,543 (GRCm39)	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20,885,107 (GRCm39)	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20,853,659 (GRCm39)	missense	probably benign
R6870:Arhgap21	UTSW	2	20,885,321 (GRCm39)	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20,855,142 (GRCm39)	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20,853,689 (GRCm39)	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20,870,198 (GRCm39)	missense	probably benign
R7237:Arhgap21	UTSW	2	20,854,783 (GRCm39)	nonsense	probably null
R7261:Arhgap21	UTSW	2	20,885,177 (GRCm39)	missense	probably benign
R7558:Arhgap21	UTSW	2	20,860,421 (GRCm39)	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20,917,102 (GRCm39)	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20,855,169 (GRCm39)	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20,854,290 (GRCm39)	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20,867,983 (GRCm39)	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20,885,524 (GRCm39)	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20,854,007 (GRCm39)	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20,867,967 (GRCm39)	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20,885,216 (GRCm39)	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20,854,221 (GRCm39)	missense	probably benign
R8486:Arhgap21	UTSW	2	20,865,236 (GRCm39)	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20,858,991 (GRCm39)	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20,972,144 (GRCm39)	nonsense	probably null
R9140:Arhgap21	UTSW	2	20,886,025 (GRCm39)	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20,858,983 (GRCm39)	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20,885,816 (GRCm39)	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20,854,061 (GRCm39)	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20,885,464 (GRCm39)	missense	probably benign
R9454:Arhgap21	UTSW	2	20,870,153 (GRCm39)	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20,896,953 (GRCm39)	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20,854,026 (GRCm39)	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20,886,283 (GRCm39)	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GGTTATAGTCTGCTGCGCTC -3'
(R):5'- TCAGGTCCTTCACATAGAACTGAAG -3'

Sequencing Primer
(F):5'- CTCTGAGATGCAGCTCGTAAG -3'
(R):5'- CCTTCACATAGAACTGAAGAGGTAAG -3'

Posted On

2018-09-12