Incidental Mutation 'R6739:Arhgap21'
ID 530344
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene Name Rho GTPase activating protein 21
Synonyms ARHGAP10, 5530401C11Rik
MMRRC Submission 044857-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.570) question?
Stock # R6739 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 20852730-20973692 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20885543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 545 (H545Y)
Ref Sequence ENSEMBL: ENSMUSP00000133851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000114594
AA Change: H549Y

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: H549Y

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141298
AA Change: H555Y

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: H555Y

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154230
AA Change: H555Y

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: H555Y

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173194
AA Change: H545Y

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: H545Y

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174584
AA Change: H384Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: H384Y

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Meta Mutation Damage Score 0.1414 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,236,658 (GRCm39) V14A probably benign Het
Ank2 A T 3: 126,873,643 (GRCm39) N59K probably damaging Het
Ano4 T C 10: 88,863,114 (GRCm39) Y286C probably damaging Het
Arid1a T A 4: 133,414,937 (GRCm39) S1152C unknown Het
Cfap73 T C 5: 120,768,258 (GRCm39) T167A probably benign Het
Ctbs A T 3: 146,165,254 (GRCm39) probably null Het
Dmgdh T A 13: 93,857,123 (GRCm39) N742K probably benign Het
Dmxl1 T C 18: 50,011,313 (GRCm39) S1157P probably benign Het
Dnm3 T C 1: 162,305,352 (GRCm39) N14S probably damaging Het
Dpp4 C T 2: 62,217,439 (GRCm39) V53I probably benign Het
Etl4 A G 2: 20,718,246 (GRCm39) N329S probably damaging Het
Fbxw25 A G 9: 109,480,699 (GRCm39) V327A probably benign Het
Gsg1 T A 6: 135,214,612 (GRCm39) Q299L probably damaging Het
Igsf23 A G 7: 19,678,673 (GRCm39) L39P probably damaging Het
Il17rd A G 14: 26,821,488 (GRCm39) R261G possibly damaging Het
Krt75 C T 15: 101,479,503 (GRCm39) D276N probably benign Het
Lox T C 18: 52,660,031 (GRCm39) T268A possibly damaging Het
Mroh4 T C 15: 74,481,568 (GRCm39) S825G probably benign Het
Nlrp9c T C 7: 26,084,850 (GRCm39) D243G probably damaging Het
Or10a5 T C 7: 106,636,018 (GRCm39) Y219H probably damaging Het
Or1x6 T A 11: 50,939,564 (GRCm39) V210E probably damaging Het
Picalm C A 7: 89,825,916 (GRCm39) T131N probably damaging Het
Pitpnm1 T A 19: 4,160,522 (GRCm39) L781H probably damaging Het
Proz A T 8: 13,123,451 (GRCm39) I241F possibly damaging Het
Rb1cc1 A G 1: 6,304,454 (GRCm39) D67G probably damaging Het
Rnf213 T A 11: 119,333,097 (GRCm39) C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Scn8a T C 15: 100,913,836 (GRCm39) I1076T possibly damaging Het
Snrnp70 A T 7: 45,036,843 (GRCm39) D100E probably damaging Het
Triobp T A 15: 78,850,566 (GRCm39) L240Q possibly damaging Het
Vmn2r5 A G 3: 64,398,637 (GRCm39) S781P probably damaging Het
Zfp451 A G 1: 33,842,675 (GRCm39) probably benign Het
Zfta C T 19: 7,398,712 (GRCm39) R243* probably null Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20,860,511 (GRCm39) missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20,854,392 (GRCm39) missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20,919,455 (GRCm39) missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20,854,448 (GRCm39) missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20,884,813 (GRCm39) missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20,885,117 (GRCm39) missense probably benign
IGL02264:Arhgap21 APN 2 20,864,850 (GRCm39) splice site probably null
IGL02346:Arhgap21 APN 2 20,884,762 (GRCm39) splice site probably benign
IGL02418:Arhgap21 APN 2 20,885,711 (GRCm39) missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20,860,399 (GRCm39) missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20,896,902 (GRCm39) missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20,865,874 (GRCm39) missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20,919,532 (GRCm39) missense probably benign
IGL03265:Arhgap21 APN 2 20,854,439 (GRCm39) missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20,885,500 (GRCm39) missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20,864,612 (GRCm39) splice site probably benign
R0363:Arhgap21 UTSW 2 20,885,944 (GRCm39) missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20,867,928 (GRCm39) missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20,919,610 (GRCm39) nonsense probably null
R0633:Arhgap21 UTSW 2 20,860,198 (GRCm39) nonsense probably null
R0905:Arhgap21 UTSW 2 20,854,745 (GRCm39) missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20,886,576 (GRCm39) nonsense probably null
R1570:Arhgap21 UTSW 2 20,885,651 (GRCm39) missense probably benign
R1686:Arhgap21 UTSW 2 20,886,659 (GRCm39) missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20,865,910 (GRCm39) missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20,866,015 (GRCm39) missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20,866,015 (GRCm39) missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20,854,331 (GRCm39) missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20,886,451 (GRCm39) missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20,868,037 (GRCm39) missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20,868,037 (GRCm39) missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20,868,037 (GRCm39) missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20,884,862 (GRCm39) missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20,859,809 (GRCm39) missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20,855,102 (GRCm39) missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20,864,717 (GRCm39) missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20,896,915 (GRCm39) missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20,891,948 (GRCm39) missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20,891,948 (GRCm39) missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20,891,948 (GRCm39) missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20,891,948 (GRCm39) missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20,891,948 (GRCm39) missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20,972,146 (GRCm39) missense probably benign
R4686:Arhgap21 UTSW 2 20,868,033 (GRCm39) missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20,854,967 (GRCm39) missense probably benign
R4834:Arhgap21 UTSW 2 20,870,130 (GRCm39) missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20,885,998 (GRCm39) missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20,885,279 (GRCm39) missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20,854,872 (GRCm39) missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20,863,800 (GRCm39) missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20,854,701 (GRCm39) missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20,884,848 (GRCm39) missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20,853,645 (GRCm39) missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20,854,127 (GRCm39) missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20,854,533 (GRCm39) missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20,885,897 (GRCm39) missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20,885,497 (GRCm39) missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20,868,024 (GRCm39) missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20,853,852 (GRCm39) missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20,886,187 (GRCm39) missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20,886,616 (GRCm39) missense probably damaging 1.00
R6817:Arhgap21 UTSW 2 20,885,107 (GRCm39) missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20,853,659 (GRCm39) missense probably benign
R6844:Arhgap21 UTSW 2 20,886,116 (GRCm39) missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20,885,321 (GRCm39) missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20,855,142 (GRCm39) missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20,853,689 (GRCm39) missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20,870,198 (GRCm39) missense probably benign
R7237:Arhgap21 UTSW 2 20,854,783 (GRCm39) nonsense probably null
R7261:Arhgap21 UTSW 2 20,885,177 (GRCm39) missense probably benign
R7558:Arhgap21 UTSW 2 20,860,421 (GRCm39) missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20,917,102 (GRCm39) missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20,855,169 (GRCm39) missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20,854,290 (GRCm39) missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20,867,983 (GRCm39) missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20,885,524 (GRCm39) missense possibly damaging 0.80
R7965:Arhgap21 UTSW 2 20,854,007 (GRCm39) missense probably damaging 1.00
R7986:Arhgap21 UTSW 2 20,867,967 (GRCm39) missense probably damaging 1.00
R8028:Arhgap21 UTSW 2 20,885,216 (GRCm39) missense probably benign 0.02
R8209:Arhgap21 UTSW 2 20,876,556 (GRCm39) missense probably damaging 1.00
R8226:Arhgap21 UTSW 2 20,876,556 (GRCm39) missense probably damaging 1.00
R8251:Arhgap21 UTSW 2 20,854,221 (GRCm39) missense probably benign
R8486:Arhgap21 UTSW 2 20,865,236 (GRCm39) missense probably damaging 1.00
R8487:Arhgap21 UTSW 2 20,886,116 (GRCm39) missense probably benign 0.08
R8508:Arhgap21 UTSW 2 20,858,991 (GRCm39) missense probably benign 0.17
R8835:Arhgap21 UTSW 2 20,972,144 (GRCm39) nonsense probably null
R9140:Arhgap21 UTSW 2 20,886,025 (GRCm39) missense probably damaging 1.00
R9190:Arhgap21 UTSW 2 20,858,983 (GRCm39) missense probably null 0.04
R9204:Arhgap21 UTSW 2 20,885,816 (GRCm39) missense probably damaging 1.00
R9227:Arhgap21 UTSW 2 20,860,469 (GRCm39) missense possibly damaging 0.92
R9230:Arhgap21 UTSW 2 20,860,469 (GRCm39) missense possibly damaging 0.92
R9308:Arhgap21 UTSW 2 20,854,061 (GRCm39) missense probably damaging 0.99
R9374:Arhgap21 UTSW 2 20,886,397 (GRCm39) missense probably damaging 1.00
R9449:Arhgap21 UTSW 2 20,885,464 (GRCm39) missense probably benign
R9454:Arhgap21 UTSW 2 20,870,153 (GRCm39) missense probably damaging 0.99
R9499:Arhgap21 UTSW 2 20,886,397 (GRCm39) missense probably damaging 1.00
R9544:Arhgap21 UTSW 2 20,858,938 (GRCm39) missense possibly damaging 0.73
R9552:Arhgap21 UTSW 2 20,886,397 (GRCm39) missense probably damaging 1.00
R9567:Arhgap21 UTSW 2 20,896,953 (GRCm39) missense possibly damaging 0.94
R9588:Arhgap21 UTSW 2 20,858,938 (GRCm39) missense possibly damaging 0.73
R9749:Arhgap21 UTSW 2 20,854,026 (GRCm39) missense probably benign 0.00
Z1191:Arhgap21 UTSW 2 20,886,283 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TACTTCGGACTTTCACGAGTGG -3'
(R):5'- AATCATAGAACTCGTTCGTGGG -3'

Sequencing Primer
(F):5'- TGCAATACCCCGTTGAAGTG -3'
(R):5'- CATAGAACTCGTTCGTGGGATTAC -3'
Posted On 2018-08-01