Incidental Mutation 'R6908:Nynrin'
ID538884
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6908 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55863878 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 335 (S335A)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect probably benign
Transcript: ENSMUST00000100529
AA Change: S335A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: S335A

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168479
AA Change: S335A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: S335A

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCCACGAACTTGGACTTTCTC -3'
(R):5'- AAGGGCAAAGGATTCCGTC -3'

Sequencing Primer
(F):5'- AACTTGGACTTTCTCTAGGGACCAG -3'
(R):5'- CTCTGCCAGAAGGGGAAATTTAAGC -3'
Posted On2018-11-06