Incidental Mutation 'R0644:Bcl9'
ID56995
Institutional Source Beutler Lab
Gene Symbol Bcl9
Ensembl Gene ENSMUSG00000038256
Gene NameB cell CLL/lymphoma 9
Synonyms8030475K17Rik, A330041G23Rik, 2610202E01Rik
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97203662-97297917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97210497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 294 (S294G)
Ref Sequence ENSEMBL: ENSMUSP00000131692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046521] [ENSMUST00000166341]
Predicted Effect probably benign
Transcript: ENSMUST00000046521
AA Change: S294G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046152
Gene: ENSMUSG00000038256
AA Change: S294G

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 389 3.1e-24 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141861
Predicted Effect probably benign
Transcript: ENSMUST00000166341
AA Change: S294G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131692
Gene: ENSMUSG00000038256
AA Change: S294G

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 388 5.2e-22 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of 1q21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Bcl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bcl9 APN 3 97207202 missense probably damaging 1.00
IGL00817:Bcl9 APN 3 97205144 missense probably damaging 0.97
IGL01609:Bcl9 APN 3 97208975 missense probably benign 0.23
IGL02245:Bcl9 APN 3 97208693 missense probably damaging 1.00
IGL02385:Bcl9 APN 3 97209278 missense probably benign 0.01
IGL02534:Bcl9 APN 3 97215229 missense probably damaging 1.00
IGL02663:Bcl9 APN 3 97205332 missense probably damaging 1.00
IGL02705:Bcl9 APN 3 97204865 missense possibly damaging 0.94
IGL02884:Bcl9 APN 3 97210052 missense probably damaging 1.00
IGL03345:Bcl9 APN 3 97209192 missense probably benign
R0312:Bcl9 UTSW 3 97209411 missense probably benign 0.27
R0602:Bcl9 UTSW 3 97205786 missense probably benign 0.00
R0627:Bcl9 UTSW 3 97205473 missense probably damaging 1.00
R1342:Bcl9 UTSW 3 97205726 missense possibly damaging 0.93
R1836:Bcl9 UTSW 3 97205870 missense probably damaging 0.97
R1886:Bcl9 UTSW 3 97215397 missense probably benign 0.04
R1931:Bcl9 UTSW 3 97205144 missense probably damaging 0.97
R1972:Bcl9 UTSW 3 97207202 missense probably damaging 1.00
R1984:Bcl9 UTSW 3 97213734 missense probably damaging 0.98
R2119:Bcl9 UTSW 3 97208915 missense probably benign 0.04
R2924:Bcl9 UTSW 3 97209753 missense probably benign 0.00
R3081:Bcl9 UTSW 3 97205673 missense possibly damaging 0.82
R3851:Bcl9 UTSW 3 97209653 missense probably damaging 0.99
R4182:Bcl9 UTSW 3 97213683 critical splice donor site probably null
R4196:Bcl9 UTSW 3 97216368 utr 5 prime probably benign
R4209:Bcl9 UTSW 3 97209953 missense probably damaging 1.00
R5082:Bcl9 UTSW 3 97209902 missense probably damaging 0.97
R5440:Bcl9 UTSW 3 97210565 missense probably benign
R5770:Bcl9 UTSW 3 97215175 missense probably benign
R5863:Bcl9 UTSW 3 97210350 missense probably benign
R5891:Bcl9 UTSW 3 97208888 missense probably damaging 1.00
R6086:Bcl9 UTSW 3 97205524 missense possibly damaging 0.73
R6305:Bcl9 UTSW 3 97205938 missense possibly damaging 0.73
R6626:Bcl9 UTSW 3 97215396 missense probably benign 0.00
R7198:Bcl9 UTSW 3 97205195 missense possibly damaging 0.87
R7198:Bcl9 UTSW 3 97208867 missense probably damaging 0.99
X0011:Bcl9 UTSW 3 97205974 missense probably benign 0.05
Z1088:Bcl9 UTSW 3 97210641 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTGCTGTGAACTCCTTCTCATCAGG -3'
(R):5'- GGACCAGAACTCTTCCCAGAATGC -3'

Sequencing Primer
(F):5'- CCCTCAGAGTTTGTAAGGAGC -3'
(R):5'- TCTTCCCAGAATGCCAGACTG -3'
Posted On2013-07-11