Incidental Mutation 'R0645:Pphln1'
ID57092
Institutional Source Beutler Lab
Gene Symbol Pphln1
Ensembl Gene ENSMUSG00000036167
Gene Nameperiphilin 1
SynonymsCR, 1600022A19Rik, 1110063K05Rik
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0645 (G1)
Quality Score186
Status Validated
Chromosome15
Chromosomal Location93398350-93491510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93420311 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 34 (V34M)
Ref Sequence ENSEMBL: ENSMUSP00000042762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049122] [ENSMUST00000068457] [ENSMUST00000109256] [ENSMUST00000165935] [ENSMUST00000229071] [ENSMUST00000230385]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049122
AA Change: V34M

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042762
Gene: ENSMUSG00000036167
AA Change: V34M

DomainStartEndE-ValueType
low complexity region 35 59 N/A INTRINSIC
low complexity region 154 174 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
Pfam:Lge1 275 365 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068457
SMART Domains Protein: ENSMUSP00000068165
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
Pfam:Lge1 179 297 8.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109256
SMART Domains Protein: ENSMUSP00000104879
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165935
SMART Domains Protein: ENSMUSP00000131121
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229071
Predicted Effect possibly damaging
Transcript: ENSMUST00000230385
AA Change: V64M

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Pphln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Pphln1 APN 15 93465210 missense probably damaging 1.00
IGL01305:Pphln1 APN 15 93489104 missense probably damaging 1.00
IGL01651:Pphln1 APN 15 93488983 missense probably damaging 1.00
IGL03219:Pphln1 APN 15 93465255 splice site probably benign
ANU22:Pphln1 UTSW 15 93489104 missense probably damaging 1.00
R0294:Pphln1 UTSW 15 93420290 missense probably damaging 1.00
R0309:Pphln1 UTSW 15 93441707 missense possibly damaging 0.55
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1879:Pphln1 UTSW 15 93424046 missense probably damaging 0.99
R1936:Pphln1 UTSW 15 93488987 missense possibly damaging 0.79
R4049:Pphln1 UTSW 15 93465106 missense probably damaging 0.99
R5034:Pphln1 UTSW 15 93452129 missense probably benign
R5472:Pphln1 UTSW 15 93488975 missense possibly damaging 0.89
R5945:Pphln1 UTSW 15 93455532 critical splice donor site probably null
R7116:Pphln1 UTSW 15 93455525 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTCCTCATTGTCATTAGGGACAGCAC -3'
(R):5'- CACTGTGAGATGGGCCACTTCTTC -3'

Sequencing Primer
(F):5'- cccatccataggggccag -3'
(R):5'- CTTCGATCATGAGAAAAACTGCG -3'
Posted On2013-07-11