Incidental Mutation 'R0645:Flrt1'
ID57105
Institutional Source Beutler Lab
Gene Symbol Flrt1
Ensembl Gene ENSMUSG00000047787
Gene Namefibronectin leucine rich transmembrane protein 1
SynonymsD630040I23Rik
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7092014-7105729 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 7097143 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040261] [ENSMUST00000113383]
Predicted Effect probably benign
Transcript: ENSMUST00000040261
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113383
AA Change: T13I
SMART Domains Protein: ENSMUSP00000109010
Gene: ENSMUSG00000047787
AA Change: T13I

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRRNT 53 85 4.11e-6 SMART
LRR 127 149 2.61e1 SMART
LRR 150 175 4.71e1 SMART
LRR 177 199 1.76e1 SMART
LRR 200 220 7.36e0 SMART
LRR 221 246 1.49e1 SMART
LRR 247 270 9.77e1 SMART
LRR 271 292 1.53e1 SMART
LRR_TYP 293 316 3.55e-6 SMART
LRRCT 328 379 5.19e-9 SMART
low complexity region 381 392 N/A INTRINSIC
FN3 434 515 1.49e0 SMART
transmembrane domain 556 578 N/A INTRINSIC
Meta Mutation Damage Score 0.0524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Flrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Flrt1 APN 19 7096912 missense probably damaging 1.00
IGL01082:Flrt1 APN 19 7095974 missense probably benign
IGL02535:Flrt1 APN 19 7096733 missense probably benign 0.00
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0403:Flrt1 UTSW 19 7095919 missense probably benign 0.01
R0677:Flrt1 UTSW 19 7096179 nonsense probably null
R1818:Flrt1 UTSW 19 7095346 missense probably damaging 1.00
R2191:Flrt1 UTSW 19 7095829 missense probably damaging 0.99
R2228:Flrt1 UTSW 19 7095358 missense probably damaging 1.00
R2471:Flrt1 UTSW 19 7096491 missense probably damaging 1.00
R4978:Flrt1 UTSW 19 7096876 missense probably damaging 1.00
R5460:Flrt1 UTSW 19 7095740 missense probably damaging 0.99
R5630:Flrt1 UTSW 19 7096465 missense probably damaging 1.00
R6326:Flrt1 UTSW 19 7096609 missense probably damaging 1.00
R6734:Flrt1 UTSW 19 7096159 missense possibly damaging 0.91
R6905:Flrt1 UTSW 19 7095392 nonsense probably null
R7239:Flrt1 UTSW 19 7095964 missense probably benign 0.12
X0024:Flrt1 UTSW 19 7095749 missense probably damaging 1.00
X0062:Flrt1 UTSW 19 7096879 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAAGCCATTGTCACAGCGGCAC -3'
(R):5'- AGCGAACAGCAGGCATTAGCATCAC -3'

Sequencing Primer
(F):5'- TCACAGCGGCACACTGATG -3'
(R):5'- GCATTAGCATCACAGAGCTTG -3'
Posted On2013-07-11