Incidental Mutation 'R2014:Map2'
ID222482
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 040023-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R2014 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66416136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1395 (V1395A)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114013
AA Change: V1395A

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: V1395A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000172886
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222
AA Change: V9A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: V9A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
Acsbg2 T A 17: 56,853,855 K263M possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Adgrl2 C T 3: 148,826,475 G1041R probably damaging Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 Q36* probably null Het
Amer3 T C 1: 34,579,444 probably benign Het
Angptl8 T C 9: 21,837,062 probably null Het
Ankmy1 T C 1: 92,885,141 D482G probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Asb13 T G 13: 3,649,512 probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cd163 G T 6: 124,325,498 W1007L probably damaging Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cp A G 3: 19,987,434 K44E probably benign Het
Crtap C A 9: 114,381,585 probably null Het
Ctsk A G 3: 95,506,692 D250G probably damaging Het
Dcp2 T C 18: 44,410,296 V307A probably benign Het
Dnah6 T A 6: 73,173,419 D787V probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ece2 A G 16: 20,642,317 T442A probably benign Het
Espl1 C T 15: 102,322,714 R17* probably null Het
Espn G T 4: 152,132,959 probably null Het
Fam20b C T 1: 156,705,941 R35Q possibly damaging Het
Fga A G 3: 83,032,757 I573V probably damaging Het
Fmo5 A G 3: 97,635,682 K103E possibly damaging Het
Frem1 A T 4: 83,005,852 V291D probably damaging Het
Gabbr1 A G 17: 37,056,782 probably null Het
Gjb6 T C 14: 57,124,756 H16R probably damaging Het
Gm438 A T 4: 144,779,725 L132Q probably damaging Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Gulo T A 14: 66,009,047 M1L probably benign Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Heatr5b T C 17: 78,814,184 D704G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hps1 G A 19: 42,762,512 P350S probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kif21b T C 1: 136,148,282 F270L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt27 A G 11: 99,349,492 V200A probably benign Het
Lama3 T C 18: 12,524,721 probably benign Het
Lmcd1 T C 6: 112,328,741 W268R probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Map3k20 C T 2: 72,438,260 T537M probably benign Het
Mdga1 A G 17: 29,849,313 S276P probably damaging Het
Mep1a T C 17: 43,497,906 N85D probably benign Het
Mettl16 A G 11: 74,817,369 S425G probably benign Het
Mthfd1l A G 10: 4,047,894 T622A probably benign Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nde1 A T 16: 14,169,457 probably benign Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc5 A G 8: 94,525,510 probably benign Het
Notch3 C A 17: 32,158,000 E310D probably benign Het
Olfr1180 T C 2: 88,412,044 T205A probably benign Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Olfr994 T A 2: 85,430,352 H159L possibly damaging Het
Osbpl5 C A 7: 143,741,692 C11F probably damaging Het
P4hb T C 11: 120,562,696 E381G probably damaging Het
Pax4 A G 6: 28,446,210 Y95H probably benign Het
Pdia3 T C 2: 121,434,820 V390A probably damaging Het
Pigv A C 4: 133,662,723 D49E possibly damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plxnb1 T A 9: 109,106,619 probably benign Het
Polq A G 16: 37,078,366 T2163A probably damaging Het
Pou5f2 T C 13: 78,025,853 S305P probably benign Het
Ppm1h A T 10: 122,920,725 H425L possibly damaging Het
Ppp1r13b G T 12: 111,833,788 D518E probably benign Het
Prf1 A T 10: 61,303,895 D544V probably benign Het
Prl3b1 T C 13: 27,247,965 F158L probably benign Het
Prss41 C T 17: 23,837,490 probably null Het
Prune2 T G 19: 17,120,523 N1130K probably damaging Het
Ptgdr2 T C 19: 10,940,425 F102S probably damaging Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rcbtb2 T C 14: 73,174,386 probably benign Het
Rgs14 C A 13: 55,383,700 S479* probably null Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sh2d4a A T 8: 68,331,083 Q223L probably damaging Het
Slc14a2 T C 18: 78,150,386 probably benign Het
Slc5a9 A C 4: 111,896,349 S52A possibly damaging Het
Slc6a18 C A 13: 73,675,725 V99L probably benign Het
Smarca2 T C 19: 26,683,905 S967P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tet3 T C 6: 83,386,075 E705G probably damaging Het
Tfeb T A 17: 47,791,559 H450Q probably damaging Het
Tmem248 G A 5: 130,231,812 E73K probably damaging Het
Trip12 A T 1: 84,760,866 L756* probably null Het
Try5 C T 6: 41,314,651 probably null Het
Tsc1 A T 2: 28,665,637 probably benign Het
Tspear G A 10: 77,875,120 probably benign Het
Ttc6 T C 12: 57,576,217 I134T possibly damaging Het
Ttn T A 2: 76,755,296 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Usp36 T C 11: 118,262,508 probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdr33 T C 18: 31,833,599 V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 Y269C possibly damaging Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCACGATGAAGAGCTTG -3'
(R):5'- GCGGATCAAAGCAAACCATG -3'

Sequencing Primer
(F):5'- CCCTCACGATGAAGAGCTTGAAATAG -3'
(R):5'- CAAGAAGAGTGAGATCATTAGTGAC -3'
Posted On2014-08-25