Incidental Mutation 'R0655:Trp53inp2'
ID62462
Institutional Source Beutler Lab
Gene Symbol Trp53inp2
Ensembl Gene ENSMUSG00000038375
Gene Nametransformation related protein 53 inducible nuclear protein 2
SynonymsTp53inp2, 1110029F20Rik
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0655 (G1)
Quality Score163
Status Not validated
Chromosome2
Chromosomal Location155381059-155389850 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 155386168 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 98 (G98*)
Ref Sequence ENSEMBL: ENSMUSP00000133880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000043237] [ENSMUST00000109670] [ENSMUST00000134218] [ENSMUST00000151466] [ENSMUST00000174685]
Predicted Effect probably benign
Transcript: ENSMUST00000043126
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000043237
AA Change: G138*
SMART Domains Protein: ENSMUSP00000037627
Gene: ENSMUSG00000038375
AA Change: G138*

DomainStartEndE-ValueType
Pfam:DOR 50 217 5.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109670
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134218
SMART Domains Protein: ENSMUSP00000119169
Gene: ENSMUSG00000038375

DomainStartEndE-ValueType
low complexity region 46 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146942
Predicted Effect probably benign
Transcript: ENSMUST00000151466
SMART Domains Protein: ENSMUSP00000121058
Gene: ENSMUSG00000038375

DomainStartEndE-ValueType
Pfam:DOR 27 100 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173406
Predicted Effect probably null
Transcript: ENSMUST00000174685
AA Change: G98*
SMART Domains Protein: ENSMUSP00000133880
Gene: ENSMUSG00000038375
AA Change: G98*

DomainStartEndE-ValueType
Pfam:DOR 42 170 2.3e-37 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene promotes autophagy and is essential for proper autophagosome formation and processing. In addition, the encoded protein can enhance rDNA transcription by helping in the assembly of the POLR1/RNA polymerase I preinitiation complex. Finally, this protein serves as a transcriptional activator for some genes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Trp53inp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Trp53inp2 APN 2 155386649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACAGCTATACAGCTCCTCCCG -3'
(R):5'- CTGGCACAGGTAACTAGGCAGAAC -3'

Sequencing Primer
(F):5'- CCTCCTTGATGGATGAGAGC -3'
(R):5'- CAATACAAGTCCTACTCTGATTCTG -3'
Posted On2013-07-30