Incidental Mutation 'T0722:Camta2'
ID67342
Institutional Source Beutler Lab
Gene Symbol Camta2
Ensembl Gene ENSMUSG00000040712
Gene Namecalmodulin binding transcription activator 2
SynonymsKiaa0909-hp
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70669463-70688105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70684005 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 75 (I75T)
Ref Sequence ENSEMBL: ENSMUSP00000104185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036299] [ENSMUST00000073625] [ENSMUST00000100933] [ENSMUST00000108541] [ENSMUST00000108542] [ENSMUST00000108543] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000119120] [ENSMUST00000120261] [ENSMUST00000126114] [ENSMUST00000145823]
Predicted Effect probably damaging
Transcript: ENSMUST00000036299
AA Change: I75T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712
AA Change: I75T

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073625
SMART Domains Protein: ENSMUSP00000073311
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 7.7e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100933
AA Change: I77T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712
AA Change: I77T

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108541
SMART Domains Protein: ENSMUSP00000104181
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 7.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108542
SMART Domains Protein: ENSMUSP00000104182
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 7.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108543
SMART Domains Protein: ENSMUSP00000104183
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 1 152 1.5e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108544
AA Change: I75T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712
AA Change: I75T

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108545
AA Change: I75T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712
AA Change: I75T

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119120
AA Change: I75T

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712
AA Change: I75T

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120261
AA Change: I75T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712
AA Change: I75T

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125687
Predicted Effect probably benign
Transcript: ENSMUST00000126114
SMART Domains Protein: ENSMUSP00000118761
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 8.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145823
AA Change: I75T

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712
AA Change: I75T

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150224
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the calmodulin-binding transcription activator protein family. Members of this family share a common domain structure that consists of a transcription activation domain, a DNA-binding domain, and a calmodulin-binding domain. The encoded protein may be a transcriptional coactivator of genes involved in cardiac growth. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious cardiac defects, but show reduced pathophysiologic cardiac hypertrophy in response to diverse stress stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Camta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Camta2 APN 11 70671482 nonsense probably null
IGL01472:Camta2 APN 11 70684124 missense probably damaging 1.00
IGL02548:Camta2 APN 11 70670685 missense probably damaging 1.00
IGL02794:Camta2 APN 11 70675658 missense possibly damaging 0.94
IGL02983:Camta2 APN 11 70672022 missense probably damaging 0.99
IGL03035:Camta2 APN 11 70671509 nonsense probably null
Willow UTSW 11 70678325 missense probably damaging 1.00
P0027:Camta2 UTSW 11 70684005 missense probably damaging 1.00
R0360:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0364:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0541:Camta2 UTSW 11 70681621 missense probably benign 0.01
R0600:Camta2 UTSW 11 70673959 missense possibly damaging 0.94
R0630:Camta2 UTSW 11 70678305 missense probably damaging 1.00
R1301:Camta2 UTSW 11 70676404 missense probably benign 0.18
R1346:Camta2 UTSW 11 70676467 missense possibly damaging 0.89
R1826:Camta2 UTSW 11 70683308 missense probably damaging 1.00
R1881:Camta2 UTSW 11 70672016 missense probably benign 0.00
R1980:Camta2 UTSW 11 70682482 missense probably benign 0.43
R2144:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2145:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2763:Camta2 UTSW 11 70682530 nonsense probably null
R2881:Camta2 UTSW 11 70679664 splice site probably null
R2917:Camta2 UTSW 11 70680961 missense probably damaging 1.00
R4115:Camta2 UTSW 11 70676474 missense possibly damaging 0.93
R4321:Camta2 UTSW 11 70678325 missense probably damaging 1.00
R4470:Camta2 UTSW 11 70680940 missense probably damaging 1.00
R4499:Camta2 UTSW 11 70674686 missense probably damaging 1.00
R4509:Camta2 UTSW 11 70681018 missense probably benign 0.28
R6154:Camta2 UTSW 11 70678385 missense probably damaging 1.00
R6166:Camta2 UTSW 11 70674261 splice site probably null
R6287:Camta2 UTSW 11 70681469 missense probably damaging 0.98
R6382:Camta2 UTSW 11 70672041 missense probably damaging 0.99
R6864:Camta2 UTSW 11 70671966 missense probably benign 0.00
R6922:Camta2 UTSW 11 70674138 missense probably benign 0.04
X0066:Camta2 UTSW 11 70681678 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGGCTCCCTGAGGGAAATGCAAG -3'
(R):5'- ACCTTTGAGAAACACGATGAGTGGC -3'

Sequencing Primer
(F):5'- TCTCCATCATGTCAAAAGGCTGG -3'
(R):5'- GCTGTCTTGTGCCCCAAAG -3'
Posted On2013-09-03