Incidental Mutation 'T0722:Papd7'
ID67350
Institutional Source Beutler Lab
Gene Symbol Papd7
Ensembl Gene ENSMUSG00000034575
Gene NamePAP associated domain containing 7
SynonymsPols, LAK-1, TRF4, TRF4-1
Accession Numbers

Ncbi RefSeq: NM_198600.2, NM_001169131.1; MGI: 2682295

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #T0722 (G3) of strain 711
Quality Score225
Status Validated
Chromosome13
Chromosomal Location69497959-69534617 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 69506955 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 224 (R224*)
Ref Sequence ENSEMBL: ENSMUSP00000152244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044081] [ENSMUST00000198607] [ENSMUST00000223344]
Predicted Effect probably null
Transcript: ENSMUST00000044081
AA Change: R224*
SMART Domains Protein: ENSMUSP00000040757
Gene: ENSMUSG00000034575
AA Change: R224*

DomainStartEndE-ValueType
Pfam:NTP_transf_2 15 124 4.1e-20 PFAM
Pfam:PAP_assoc 178 238 5.4e-19 PFAM
low complexity region 343 368 N/A INTRINSIC
low complexity region 496 505 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198607
AA Change: R467*
SMART Domains Protein: ENSMUSP00000142516
Gene: ENSMUSG00000034575
AA Change: R467*

DomainStartEndE-ValueType
low complexity region 46 98 N/A INTRINSIC
low complexity region 106 118 N/A INTRINSIC
low complexity region 122 145 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
Pfam:NTP_transf_2 258 368 1.6e-14 PFAM
Pfam:PAP_assoc 421 481 8.3e-16 PFAM
low complexity region 586 611 N/A INTRINSIC
low complexity region 739 748 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223344
AA Change: R224*
Meta Mutation Damage Score 0.6228 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase that is likely involved in DNA repair. In addition, the encoded protein may be required for sister chromatid adhesion. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Sytl1 C A 4: 133,256,851 probably benign Het
Sytl1 A G 4: 133,256,853 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Papd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Papd7 APN 13 69500559 missense probably benign 0.02
IGL02690:Papd7 APN 13 69510625 missense probably benign 0.01
IGL03047:Papd7 UTSW 13 69502911 missense probably damaging 1.00
P0027:Papd7 UTSW 13 69506955 nonsense probably null
R0309:Papd7 UTSW 13 69499932 missense possibly damaging 0.95
R1713:Papd7 UTSW 13 69503051 missense probably benign 0.10
R2936:Papd7 UTSW 13 69502327 missense possibly damaging 0.82
R3809:Papd7 UTSW 13 69512996 missense probably damaging 0.98
R4927:Papd7 UTSW 13 69502900 splice site probably null
R6419:Papd7 UTSW 13 69510666 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGCAAGAGCAACATTTGCAGTGAC -3'
(R):5'- ATCCAAGAATCGATGCCCGGAGAG -3'

Sequencing Primer
(F):5'- ATGCTTCCTTCCTGAAGTGAATG -3'
(R):5'- ATGCCCGGAGAGCTGATG -3'
Posted On2013-09-03