Incidental Mutation 'R1193:Rars'
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
MMRRC Submission 039265-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1193 (G1)
Quality Score167
Status Not validated
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35809326 bp
Amino Acid Change Alanine to Threonine at position 548 (A548T)
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018992
AA Change: A548T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848
AA Change: A548T

Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,712,144 D49G probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Gpm6a A T 8: 55,047,233 probably null Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt5 G A 2: 5,863,600 S103N probably benign Het
Olfr1336 A G 7: 6,460,716 N69S probably benign Het
Olfr1431 A T 19: 12,210,439 Y291F probably damaging Het
Pds5a G T 5: 65,637,802 A697E probably damaging Het
Pik3ca A G 3: 32,456,093 D806G probably damaging Het
Rfk C T 19: 17,395,321 P69L probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sp4 C T 12: 118,299,246 R355H possibly damaging Het
Tcaim T C 9: 122,818,830 Y137H probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem150c T C 5: 100,083,592 T175A probably damaging Het
Twnk A G 19: 45,007,790 K221E probably damaging Het
Vmn2r67 T C 7: 85,151,445 K428E probably damaging Het
Vmn2r82 T A 10: 79,377,905 Y108* probably null Het
Wwox G A 8: 114,679,874 V202M probably benign Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2055:Rars UTSW 11 35826583 splice site probably benign
R2294:Rars UTSW 11 35817536 splice site probably benign
R4281:Rars UTSW 11 35821224 missense probably damaging 1.00
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6550:Rars UTSW 11 35833183 missense probably benign 0.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7822:Rars UTSW 11 35819966 missense probably damaging 0.99
R7856:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tttttgagccagagtcttgataac -3'
Posted On2014-01-15