Incidental Mutation 'R1281:Aim2'
ID 151014
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Name absent in melanoma 2
Synonyms Ifi210, LOC383619
MMRRC Submission 039347-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1281 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173178445-173293606 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 173287377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 126 (K126*)
Ref Sequence ENSEMBL: ENSMUSP00000132253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000151176] [ENSMUST00000166137] [ENSMUST00000173023]
AlphaFold Q91VJ1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135370
Predicted Effect probably null
Transcript: ENSMUST00000147604
AA Change: K126*
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: K126*

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151176
SMART Domains Protein: ENSMUSP00000121333
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 79 9.28e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166137
AA Change: K126*
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: K126*

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192575
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C9 A T 15: 6,519,321 (GRCm39) N386I possibly damaging Het
Csnk1e A C 15: 79,304,841 (GRCm39) N387K possibly damaging Het
Cul9 T C 17: 46,822,460 (GRCm39) T1758A probably damaging Het
Dcaf17 A G 2: 70,908,500 (GRCm39) I256V probably damaging Het
Duox1 G A 2: 122,157,569 (GRCm39) C565Y probably damaging Het
Fchsd2 A G 7: 100,902,759 (GRCm39) H379R possibly damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Krt1c C A 15: 101,721,727 (GRCm39) C438F probably damaging Het
Mast4 G A 13: 102,887,086 (GRCm39) T1001I probably damaging Het
Mrc1 T C 2: 14,298,321 (GRCm39) F726L probably damaging Het
Mroh2a T TN 1: 88,183,889 (GRCm39) probably null Het
Mttp T C 3: 137,812,980 (GRCm39) N550S possibly damaging Het
Necap1 G T 6: 122,851,573 (GRCm39) D16Y possibly damaging Het
Nox3 A T 17: 3,746,460 (GRCm39) I26N probably damaging Het
Patj T C 4: 98,304,932 (GRCm39) I262T probably damaging Het
Pcdh8 T C 14: 80,005,166 (GRCm39) E953G probably damaging Het
Pirb A T 7: 3,720,189 (GRCm39) C395S probably damaging Het
Sacs A G 14: 61,429,250 (GRCm39) I433M probably benign Het
Sclt1 A G 3: 41,602,055 (GRCm39) F552L probably benign Het
Smc5 T C 19: 23,213,247 (GRCm39) N479S probably benign Het
Tg G A 15: 66,568,338 (GRCm39) V1342I probably benign Het
Ube2n C A 10: 95,377,618 (GRCm39) N132K probably benign Het
Vmn2r55 A T 7: 12,404,825 (GRCm39) C193S probably benign Het
Zc3hav1 A G 6: 38,330,872 (GRCm39) C96R probably damaging Het
Zfp60 T A 7: 27,437,852 (GRCm39) V53E probably damaging Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173,283,031 (GRCm39) missense probably benign 0.23
IGL01086:Aim2 APN 1 173,282,999 (GRCm39) missense probably damaging 0.99
IGL02292:Aim2 APN 1 173,289,840 (GRCm39) missense probably benign 0.05
IGL02382:Aim2 APN 1 173,287,315 (GRCm39) splice site probably null
R0226:Aim2 UTSW 1 173,289,899 (GRCm39) unclassified probably benign
R0609:Aim2 UTSW 1 173,289,530 (GRCm39) missense probably damaging 0.98
R2054:Aim2 UTSW 1 173,291,548 (GRCm39) missense probably damaging 1.00
R2110:Aim2 UTSW 1 173,287,279 (GRCm39) missense probably benign 0.00
R4080:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4081:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4082:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4452:Aim2 UTSW 1 173,283,010 (GRCm39) missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173,283,090 (GRCm39) synonymous silent
R4731:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173,287,372 (GRCm39) missense probably benign 0.04
R5009:Aim2 UTSW 1 173,282,932 (GRCm39) missense probably damaging 0.96
R6290:Aim2 UTSW 1 173,289,681 (GRCm39) missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173,282,802 (GRCm39) splice site probably null
R6821:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6836:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6838:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6994:Aim2 UTSW 1 173,283,152 (GRCm39) missense possibly damaging 0.80
R7893:Aim2 UTSW 1 173,291,492 (GRCm39) missense possibly damaging 0.95
R8175:Aim2 UTSW 1 173,282,920 (GRCm39) start codon destroyed possibly damaging 0.75
R8459:Aim2 UTSW 1 173,289,536 (GRCm39) unclassified probably benign
R8680:Aim2 UTSW 1 173,289,786 (GRCm39) missense probably damaging 1.00
X0021:Aim2 UTSW 1 173,291,485 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGACCACATATCAGTCACAGGAA -3'
(R):5'- GCAGACATATCTCTCCTATCGTAGCCC -3'

Sequencing Primer
(F):5'- gaggacctgaagatgggaaac -3'
(R):5'- ATCGTAGCCCGGTTTTCCTG -3'
Posted On 2014-01-29