Incidental Mutation 'R0609:Aim2'
ID 54476
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Name absent in melanoma 2
Synonyms Ifi210, LOC383619
MMRRC Submission 038798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R0609 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173178445-173293606 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 173289530 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 158 (D158N)
Ref Sequence ENSEMBL: ENSMUSP00000132253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000166137] [ENSMUST00000173023]
AlphaFold Q91VJ1
Predicted Effect probably damaging
Transcript: ENSMUST00000147604
AA Change: D158N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: D158N

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166137
AA Change: D158N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: D158N

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192575
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,533,418 (GRCm39) probably null Het
Abcb4 T A 5: 8,997,376 (GRCm39) C952S probably damaging Het
Adamtsl2 A G 2: 26,979,647 (GRCm39) D272G probably benign Het
Aldh3b1 C T 19: 3,964,024 (GRCm39) R426H probably damaging Het
Apoc2 A G 7: 19,407,278 (GRCm39) S28P probably benign Het
Arfgef3 G A 10: 18,473,179 (GRCm39) T1628I probably benign Het
Atp10a G A 7: 58,469,488 (GRCm39) probably null Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Bmp8b T A 4: 123,015,692 (GRCm39) D226E probably benign Het
Brsk2 T C 7: 141,552,229 (GRCm39) Y618H probably damaging Het
Casp12 T A 9: 5,346,554 (GRCm39) F27Y probably damaging Het
Casp8 T A 1: 58,883,951 (GRCm39) N439K probably benign Het
Ccdc175 T A 12: 72,204,281 (GRCm39) K253N probably benign Het
Cdc42bpa A G 1: 179,867,744 (GRCm39) H193R probably damaging Het
Cdk17 T C 10: 93,052,334 (GRCm39) M105T probably benign Het
Cdon C A 9: 35,389,907 (GRCm39) P854T probably damaging Het
Cep44 A G 8: 56,997,187 (GRCm39) M117T possibly damaging Het
Cep89 A T 7: 35,134,955 (GRCm39) E674D probably damaging Het
Cit C T 5: 116,012,002 (GRCm39) A203V probably damaging Het
Clstn1 C A 4: 149,713,757 (GRCm39) probably null Het
Col7a1 T A 9: 108,787,215 (GRCm39) D565E unknown Het
Cpb1 T A 3: 20,316,638 (GRCm39) Y304F probably damaging Het
Cps1 T G 1: 67,211,961 (GRCm39) Y710D probably damaging Het
Creb3l1 T C 2: 91,817,398 (GRCm39) T372A possibly damaging Het
Dars1 A G 1: 128,333,118 (GRCm39) V102A probably benign Het
Dhx35 C T 2: 158,659,335 (GRCm39) T168I possibly damaging Het
Dnah5 T C 15: 28,327,925 (GRCm39) S2100P probably benign Het
Dst T C 1: 34,306,041 (GRCm39) probably null Het
Egflam A C 15: 7,283,004 (GRCm39) L351R possibly damaging Het
Elp2 T A 18: 24,759,213 (GRCm39) D523E probably benign Het
Exo5 C A 4: 120,778,881 (GRCm39) G328V probably damaging Het
Fut9 A G 4: 25,620,811 (GRCm39) M1T probably null Het
Galnt5 A G 2: 57,914,637 (GRCm39) N584S possibly damaging Het
Gbp3 T C 3: 142,273,533 (GRCm39) V360A probably damaging Het
Gdf6 G A 4: 9,859,977 (GRCm39) C353Y probably damaging Het
Hace1 A G 10: 45,524,965 (GRCm39) T244A probably damaging Het
Hr T C 14: 70,797,097 (GRCm39) I500T probably benign Het
Ifnl2 A T 7: 28,208,707 (GRCm39) L115Q probably damaging Het
Iigp1 T C 18: 60,522,896 (GRCm39) F5L probably benign Het
Inhbb A G 1: 119,345,146 (GRCm39) L381P probably damaging Het
Irx3 A T 8: 92,527,721 (GRCm39) S50T probably benign Het
Ivns1abp C T 1: 151,235,896 (GRCm39) T363I probably benign Het
Izumo1 A T 7: 45,272,323 (GRCm39) T35S probably benign Het
Kank4 A G 4: 98,665,342 (GRCm39) S651P probably damaging Het
Kit T C 5: 75,771,539 (GRCm39) V232A probably benign Het
Klhl11 T C 11: 100,354,540 (GRCm39) Y427C probably damaging Het
Laptm4b T A 15: 34,258,835 (GRCm39) N36K probably damaging Het
Lrrk1 T C 7: 65,916,363 (GRCm39) probably null Het
Mamdc4 G T 2: 25,454,205 (GRCm39) Q1042K probably benign Het
Mical2 A G 7: 111,920,647 (GRCm39) probably null Het
Ms4a3 C A 19: 11,608,725 (GRCm39) V176F possibly damaging Het
Myo3a T C 2: 22,338,324 (GRCm39) V427A probably benign Het
Myo3a A C 2: 22,401,110 (GRCm39) E626D possibly damaging Het
Nckap5 A T 1: 125,955,025 (GRCm39) L509* probably null Het
Ndufa5 A T 6: 24,519,248 (GRCm39) D64E possibly damaging Het
Nedd4l T C 18: 65,341,532 (GRCm39) Y753H probably damaging Het
Nynrin T C 14: 56,110,218 (GRCm39) V1775A probably damaging Het
Oplah A G 15: 76,187,192 (GRCm39) S570P probably benign Het
Or14c39 T C 7: 86,344,084 (GRCm39) V140A possibly damaging Het
Or2ag1b A T 7: 106,288,205 (GRCm39) H244Q probably damaging Het
Or4q3 T C 14: 50,583,383 (GRCm39) Y141C probably damaging Het
Or5t18 A G 2: 86,637,205 (GRCm39) L46S probably damaging Het
Or9r3 G A 10: 129,948,449 (GRCm39) S70F probably damaging Het
Osbpl11 C A 16: 33,054,814 (GRCm39) Y632* probably null Het
Osbpl5 A T 7: 143,248,558 (GRCm39) L644Q probably damaging Het
Pcdhb19 T C 18: 37,631,005 (GRCm39) W267R probably benign Het
Pkhd1l1 A C 15: 44,330,820 (GRCm39) S132R possibly damaging Het
Pramel23 A T 4: 143,425,073 (GRCm39) D123E probably benign Het
Ptpn13 T A 5: 103,704,011 (GRCm39) S1348T probably benign Het
Rc3h1 T A 1: 160,757,705 (GRCm39) W8R probably damaging Het
Rgs3 T G 4: 62,544,173 (GRCm39) V315G probably damaging Het
Rora T A 9: 69,269,151 (GRCm39) M82K probably damaging Het
Rph3al T C 11: 75,799,795 (GRCm39) I55V probably benign Het
Sag T C 1: 87,740,713 (GRCm39) V45A probably damaging Het
Scn3a T C 2: 65,366,854 (GRCm39) E56G probably damaging Het
Sec24c T G 14: 20,737,016 (GRCm39) V324G probably damaging Het
Sptbn1 A G 11: 30,088,979 (GRCm39) L748S probably damaging Het
Stard9 A T 2: 120,536,787 (GRCm39) D4186V probably damaging Het
Stk39 T C 2: 68,196,511 (GRCm39) E306G probably damaging Het
Sycp1 C A 3: 102,806,165 (GRCm39) probably null Het
Taf2 A C 15: 54,923,446 (GRCm39) L277R probably damaging Het
Tasor C T 14: 27,183,707 (GRCm39) T722I probably benign Het
Tbc1d23 T A 16: 56,993,469 (GRCm39) I566F possibly damaging Het
Tekt5 T C 16: 10,179,168 (GRCm39) T400A possibly damaging Het
Tgfbrap1 T C 1: 43,099,301 (GRCm39) H401R probably benign Het
Tie1 T A 4: 118,333,344 (GRCm39) I841L possibly damaging Het
Tln1 T G 4: 43,544,645 (GRCm39) T1095P possibly damaging Het
Tmem147 A G 7: 30,427,527 (GRCm39) Y72H probably benign Het
Tnfaip2 A G 12: 111,419,941 (GRCm39) N691S probably benign Het
Trim24 G A 6: 37,934,718 (GRCm39) C811Y probably damaging Het
Trim30b T A 7: 104,007,183 (GRCm39) probably benign Het
Trpc4 T G 3: 54,102,189 (GRCm39) L29R probably damaging Het
Trpm6 A T 19: 18,803,226 (GRCm39) I890F probably damaging Het
Ttc23l C T 15: 10,504,622 (GRCm39) E442K probably benign Het
Tut7 A T 13: 59,947,596 (GRCm39) C506* probably null Het
Uggt2 A G 14: 119,332,748 (GRCm39) V62A probably damaging Het
Ugt1a6a C A 1: 88,066,606 (GRCm39) S137R probably benign Het
Unc13a A G 8: 72,111,111 (GRCm39) Y367H probably damaging Het
Vmn2r49 A G 7: 9,710,233 (GRCm39) I833T probably benign Het
Vmn2r7 T C 3: 64,623,900 (GRCm39) D231G probably benign Het
Ythdc2 A T 18: 44,997,424 (GRCm39) M994L probably benign Het
Zfp804a G A 2: 82,087,932 (GRCm39) S587N probably damaging Het
Zswim2 A G 2: 83,754,003 (GRCm39) I219T probably benign Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173,283,031 (GRCm39) missense probably benign 0.23
IGL01086:Aim2 APN 1 173,282,999 (GRCm39) missense probably damaging 0.99
IGL02292:Aim2 APN 1 173,289,840 (GRCm39) missense probably benign 0.05
IGL02382:Aim2 APN 1 173,287,315 (GRCm39) splice site probably null
R0226:Aim2 UTSW 1 173,289,899 (GRCm39) unclassified probably benign
R1281:Aim2 UTSW 1 173,287,377 (GRCm39) nonsense probably null
R2054:Aim2 UTSW 1 173,291,548 (GRCm39) missense probably damaging 1.00
R2110:Aim2 UTSW 1 173,287,279 (GRCm39) missense probably benign 0.00
R4080:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4081:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4082:Aim2 UTSW 1 173,287,417 (GRCm39) critical splice donor site probably null
R4452:Aim2 UTSW 1 173,283,010 (GRCm39) missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173,283,090 (GRCm39) synonymous silent
R4731:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173,291,442 (GRCm39) missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173,287,372 (GRCm39) missense probably benign 0.04
R5009:Aim2 UTSW 1 173,282,932 (GRCm39) missense probably damaging 0.96
R6290:Aim2 UTSW 1 173,289,681 (GRCm39) missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173,282,802 (GRCm39) splice site probably null
R6821:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6836:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6838:Aim2 UTSW 1 173,291,546 (GRCm39) missense probably damaging 1.00
R6994:Aim2 UTSW 1 173,283,152 (GRCm39) missense possibly damaging 0.80
R7893:Aim2 UTSW 1 173,291,492 (GRCm39) missense possibly damaging 0.95
R8175:Aim2 UTSW 1 173,282,920 (GRCm39) start codon destroyed possibly damaging 0.75
R8459:Aim2 UTSW 1 173,289,536 (GRCm39) unclassified probably benign
R8680:Aim2 UTSW 1 173,289,786 (GRCm39) missense probably damaging 1.00
X0021:Aim2 UTSW 1 173,291,485 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGAGTCAGTAAAACTGCCCC -3'
(R):5'- GTGACCTCCATGAAGTTACTGTGCC -3'

Sequencing Primer
(F):5'- TCAGTAAAACTGCCCCGTCTG -3'
(R):5'- CCATGAAGTTACTGTGCCAAAGG -3'
Posted On 2013-07-11