Incidental Mutation 'R6994:Aim2'
ID544016
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Nameabsent in melanoma 2
SynonymsLOC383619, Ifi210
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6994 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173350879-173466040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173455586 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 78 (A78V)
Ref Sequence ENSEMBL: ENSMUSP00000134329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000151176] [ENSMUST00000166137] [ENSMUST00000173023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000147604
AA Change: A78V

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: A78V

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151176
AA Change: A78V

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121333
Gene: ENSMUSG00000037860
AA Change: A78V

DomainStartEndE-ValueType
PYRIN 6 79 9.28e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166137
AA Change: A78V

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: A78V

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173023
AA Change: A78V

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860
AA Change: A78V

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T G 4: 144,623,279 W369G probably damaging Het
Abhd16b C T 2: 181,493,668 T121M possibly damaging Het
Adam5 A T 8: 24,786,246 C468* probably null Het
Alg9 G A 9: 50,792,122 W254* probably null Het
Ankrd55 G C 13: 112,368,300 E499Q probably benign Het
Atp6v0a2 T C 5: 124,714,145 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bpi A T 2: 158,258,244 probably benign Het
Bves A G 10: 45,339,418 H63R probably benign Het
Ccdc183 T C 2: 25,617,045 M45V probably benign Het
Cmklr1 T C 5: 113,614,922 Y6C probably damaging Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Ctsm T A 13: 61,539,884 E53D probably damaging Het
Cyp2a22 A G 7: 26,939,181 probably null Het
Ddx10 A G 9: 53,204,111 V641A probably damaging Het
Ddx6 T C 9: 44,628,723 V316A probably damaging Het
Dhx34 T C 7: 16,203,874 D767G probably benign Het
Dtnbp1 T A 13: 45,001,929 D15V probably damaging Het
Dtx3l C T 16: 35,931,372 probably null Het
Entpd8 T C 2: 25,083,309 I162T probably damaging Het
Fam186a G T 15: 99,942,466 Q1966K probably benign Het
Fbxo27 A C 7: 28,693,360 D22A probably damaging Het
Fermt3 A T 19: 6,999,727 I577N probably damaging Het
Frmd8 A T 19: 5,873,181 S81T probably damaging Het
Gm4788 T A 1: 139,736,930 I464L possibly damaging Het
Gm5108 T A 5: 67,944,669 probably benign Het
Gm9195 T C 14: 72,480,831 Y135C probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2afy T C 13: 56,089,830 N206D probably benign Het
Kcnh8 A T 17: 52,977,695 I898F probably benign Het
Kri1 C T 9: 21,287,787 probably benign Het
Krt32 T A 11: 100,086,445 I210F probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lpin3 C T 2: 160,904,883 P766L probably damaging Het
Marf1 T C 16: 14,128,857 T1169A probably damaging Het
Morc1 G A 16: 48,565,621 V536M probably benign Het
Morc1 A T 16: 48,618,546 H768L probably benign Het
Mpped2 T A 2: 106,699,533 H42Q possibly damaging Het
Nfatc1 G T 18: 80,653,564 probably null Het
Nfkbid G A 7: 30,425,767 S263N probably benign Het
Npas3 C A 12: 54,068,793 Q802K probably damaging Het
Olfr202 T G 16: 59,284,090 M136L possibly damaging Het
Olfr492 T A 7: 108,322,894 I261F possibly damaging Het
Olfr591 T C 7: 103,172,912 T242A probably damaging Het
Pabpc4l C A 3: 46,446,910 V100L possibly damaging Het
Pagr1a A G 7: 127,016,441 probably null Het
Pcdh1 A T 18: 38,198,500 N483K probably damaging Het
Pih1d3 T C 1: 31,222,909 probably benign Het
Pikfyve C A 1: 65,252,530 P1303T probably damaging Het
Plekhh3 T A 11: 101,165,693 probably null Het
Pnkd T A 1: 74,293,176 probably null Het
Pparg A T 6: 115,451,050 Q166L probably benign Het
Psenen A G 7: 30,563,507 probably null Het
Rab4a T C 8: 123,830,366 S142P probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Relt A C 7: 100,853,114 probably benign Het
Rftn1 T A 17: 50,036,991 T90S possibly damaging Het
Ripor3 T G 2: 167,997,266 D105A probably damaging Het
Rnase10 T A 14: 51,009,681 I135N probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rttn A G 18: 89,028,899 E895G probably damaging Het
Serpina3a G A 12: 104,112,830 probably null Het
Slco5a1 C T 1: 12,881,393 C562Y probably damaging Het
Spen T C 4: 141,493,459 T396A unknown Het
Tgfbr3 A G 5: 107,133,026 S623P probably damaging Het
Tmem8b A G 4: 43,690,192 I876V probably damaging Het
Tmod3 T C 9: 75,509,387 K221R probably damaging Het
Tomm40 G T 7: 19,702,906 D40E probably damaging Het
Trav6d-4 G T 14: 52,753,591 G28V probably damaging Het
Trav8d-2 G T 14: 53,042,476 A17S probably benign Het
Triml2 T C 8: 43,190,078 C158R possibly damaging Het
Trip10 A G 17: 57,255,331 E283G probably damaging Het
Tubb2b T C 13: 34,127,535 Y425C probably damaging Het
Ubr1 T C 2: 120,963,593 T37A probably benign Het
Unc13b A G 4: 43,171,403 probably benign Het
Unc13b A G 4: 43,173,203 probably benign Het
Vcan A T 13: 89,693,407 D379E possibly damaging Het
Vmn1r44 T A 6: 89,894,158 H295Q probably benign Het
Vmn2r16 A T 5: 109,340,103 S281C probably damaging Het
Vmn2r84 C T 10: 130,391,007 A321T possibly damaging Het
Vsig10l A T 7: 43,465,067 H271L possibly damaging Het
Vwa8 A T 14: 78,908,156 H91L possibly damaging Het
Zfp957 T A 14: 79,213,690 E223V probably damaging Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173455465 missense probably benign 0.23
IGL01086:Aim2 APN 1 173455433 missense probably damaging 0.99
IGL02292:Aim2 APN 1 173462274 missense probably benign 0.05
IGL02382:Aim2 APN 1 173459749 unclassified probably null
R0226:Aim2 UTSW 1 173462333 unclassified probably benign
R0609:Aim2 UTSW 1 173461964 missense probably damaging 0.98
R1281:Aim2 UTSW 1 173459811 nonsense probably null
R2054:Aim2 UTSW 1 173463982 missense probably damaging 1.00
R2110:Aim2 UTSW 1 173459713 missense probably benign 0.00
R4080:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4081:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4082:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4452:Aim2 UTSW 1 173455444 missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173455524 synonymous silent
R4731:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173459806 missense probably benign 0.04
R5009:Aim2 UTSW 1 173455366 missense probably damaging 0.96
R6290:Aim2 UTSW 1 173462115 missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173455236 intron probably null
R6821:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6836:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6838:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R7893:Aim2 UTSW 1 173463926 missense possibly damaging 0.95
R7976:Aim2 UTSW 1 173463926 missense possibly damaging 0.95
X0021:Aim2 UTSW 1 173463919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTGTTGTTGACCGGCC -3'
(R):5'- TGACTACCGGCATCAGACAC -3'

Sequencing Primer
(F):5'- TTGTTGACCGGCCTGGAC -3'
(R):5'- CGGCTAAGGAATTTGTAACATGCTG -3'
Posted On2019-05-13