Incidental Mutation 'R1351:AW146154'
ID156653
Institutional Source Beutler Lab
Gene Symbol AW146154
Ensembl Gene ENSMUSG00000074166
Gene Nameexpressed sequence AW146154
Synonyms
MMRRC Submission 039416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1351 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41478874-41499890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41480454 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 413 (C413S)
Ref Sequence ENSEMBL: ENSMUSP00000096109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000098509]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably damaging
Transcript: ENSMUST00000098509
AA Change: C413S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096109
Gene: ENSMUSG00000074166
AA Change: C413S

DomainStartEndE-ValueType
KRAB 4 66 9.86e-14 SMART
ZnF_C2H2 75 97 9.08e1 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 4.72e-2 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 4.24e-4 SMART
ZnF_C2H2 271 293 5.81e-2 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.6e-4 SMART
ZnF_C2H2 383 405 8.47e-4 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205572
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 A G 3: 62,380,841 E444G probably damaging Het
Astl G A 2: 127,347,185 V144M possibly damaging Het
Bicdl2 G A 17: 23,667,545 probably benign Het
Cacna1h G T 17: 25,391,951 S624R probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cep126 C T 9: 8,100,086 E816K probably damaging Het
Cyp2j13 T C 4: 96,056,918 K291R probably benign Het
Defb26 A T 2: 152,507,817 M181K unknown Het
Dicer1 G A 12: 104,729,142 R177C probably damaging Het
Eif4g2 A G 7: 111,074,080 Y831H probably damaging Het
Ermap C T 4: 119,181,361 probably null Het
Fcamr C T 1: 130,813,020 T392I possibly damaging Het
Fgf3 T C 7: 144,840,780 probably benign Het
Gpr162 T C 6: 124,861,198 Y163C probably damaging Het
Gprc5d T C 6: 135,116,232 R226G possibly damaging Het
Hapln3 A C 7: 79,121,960 S60R probably damaging Het
Hif1a T C 12: 73,940,461 S443P probably benign Het
Irf2bpl A G 12: 86,882,624 M425T probably benign Het
Lrrc39 G T 3: 116,565,820 A5S possibly damaging Het
Mbtps1 A G 8: 119,518,162 L850S possibly damaging Het
Mios T A 6: 8,228,120 M679K possibly damaging Het
Mocos T C 18: 24,660,050 F68S probably damaging Het
Nuf2 T C 1: 169,510,549 probably benign Het
Olfr639 A G 7: 104,012,316 Y129H possibly damaging Het
Orc1 T A 4: 108,595,367 D146E probably benign Het
Papd5 C A 8: 88,200,374 Y137* probably null Het
Pcdhb22 T C 18: 37,518,574 F32L probably benign Het
Pde4d G T 13: 109,951,275 E562D possibly damaging Het
Pgk2 T C 17: 40,207,800 K246E probably damaging Het
Plekhh2 A T 17: 84,577,146 probably benign Het
Pou3f2 A T 4: 22,487,162 C324S probably damaging Het
Prkdc C T 16: 15,667,700 L464F possibly damaging Het
Prrc2a T C 17: 35,157,887 H749R possibly damaging Het
Rad18 T C 6: 112,620,902 N218S possibly damaging Het
Rbm11 T C 16: 75,596,643 Y76H possibly damaging Het
Rif1 T G 2: 52,111,555 Y1674D possibly damaging Het
Rrp1b A G 17: 32,056,637 H386R possibly damaging Het
Sacs T C 14: 61,202,761 V752A probably benign Het
Sema3c A G 5: 17,678,336 D314G possibly damaging Het
Spata2l G A 8: 123,233,333 R406C probably damaging Het
Tacc2 C T 7: 130,663,003 probably benign Het
Trpc4 A G 3: 54,195,002 E107G probably damaging Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Xdh A G 17: 73,923,078 I286T probably benign Het
Zfp608 T C 18: 54,898,391 T826A probably benign Het
Zfp646 T A 7: 127,883,511 V1620E probably benign Het
Zfyve28 T G 5: 34,232,205 D217A probably damaging Het
Zmym6 G A 4: 127,123,005 G768R probably benign Het
Other mutations in AW146154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:AW146154 APN 7 41480459 missense probably damaging 1.00
R3763:AW146154 UTSW 7 41480370 missense probably damaging 1.00
R4829:AW146154 UTSW 7 41480633 missense possibly damaging 0.62
R4835:AW146154 UTSW 7 41480468 missense probably damaging 1.00
R5326:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5542:AW146154 UTSW 7 41481377 missense probably benign 0.00
R5976:AW146154 UTSW 7 41480297 missense probably damaging 0.99
R6252:AW146154 UTSW 7 41481387 missense probably benign 0.10
R7006:AW146154 UTSW 7 41481224 missense possibly damaging 0.50
R7053:AW146154 UTSW 7 41482564 critical splice donor site probably null
R7096:AW146154 UTSW 7 41481443 missense probably benign 0.32
R7649:AW146154 UTSW 7 41480732 missense probably benign 0.13
R8069:AW146154 UTSW 7 41480511 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTCATCAGGGCATAATAAACAGGGATATAA -3'
(R):5'- GTCACAgtagtctccgaatacataaaagaaca -3'

Sequencing Primer
(F):5'- tggctcttgatttctaagattacac -3'
(R):5'- acataaaaggacacatacagcag -3'
Posted On2014-02-11