Incidental Mutation 'R1314:Zfp819'
ID 157504
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
MMRRC Submission 039380-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R1314 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 43607169-43618285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43617056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 321 (T321I)
Ref Sequence ENSEMBL: ENSMUSP00000112026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935] [ENSMUST00000127765]
AlphaFold Q80V81
Predicted Effect probably benign
Transcript: ENSMUST00000032661
AA Change: T321I

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: T321I

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116324
AA Change: T321I

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: T321I

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120935
AA Change: T245I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: T245I

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127765
SMART Domains Protein: ENSMUSP00000116658
Gene: ENSMUSG00000055102

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,329,071 L659P probably damaging Het
Cachd1 G T 4: 100,974,917 G759C probably damaging Het
Depdc5 T A 5: 32,877,074 V95E probably damaging Het
Filip1 T A 9: 79,820,566 H257L probably damaging Het
Gfi1 A T 5: 107,721,874 probably null Het
Golim4 T C 3: 75,886,288 E579G probably damaging Het
Ikbkap T A 4: 56,786,647 H432L probably benign Het
Kcnip1 A G 11: 33,642,481 W140R probably damaging Het
Nutm1 A G 2: 112,249,809 I587T probably benign Het
Olfr1257 A G 2: 89,880,877 E17G probably benign Het
Prkag3 A G 1: 74,747,184 S201P probably damaging Het
Prkdc C T 16: 15,664,227 A378V possibly damaging Het
Rarb A G 14: 16,508,932 probably null Het
Rfc2 T A 5: 134,591,200 N167K probably damaging Het
Rnf43 A G 11: 87,732,319 T749A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tectb A G 19: 55,183,985 N155D probably damaging Het
Tnpo1 G A 13: 98,860,722 P400S probably damaging Het
Ugt8a T C 3: 125,871,748 T367A probably benign Het
Vmn2r39 A T 7: 9,014,982 M785K probably damaging Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1301:Zfp819 UTSW 7 43617100 missense possibly damaging 0.94
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4545:Zfp819 UTSW 7 43617785 missense probably damaging 0.98
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R5053:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43616696 missense probably benign 0.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7813:Zfp819 UTSW 7 43616767 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43617779 missense probably benign 0.04
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTCTTTCTCAGGACAAGCCAG -3'
(R):5'- GATGCATAGACAAACAATTTCCCGCAG -3'

Sequencing Primer
(F):5'- TCTCAGGACAAGCCAGTTGAATATAC -3'
(R):5'- cacagtcagaacacacataagg -3'
Posted On 2014-02-18